#11  
قديم 11-22-2015, 10:17 PM
رافت ابراهيم رافت ابراهيم غير متواجد حالياً
عضو ذهبي
 
تاريخ التسجيل: Dec 2011
المشاركات: 520
افتراضي النقي وراثي جسمي قاهر الشلل النصفي التشنجي: والسريرية، اسريرية، ودراسة وراثية

 

http://jnnp.bmj.com/content/64/1/61.full



وقد وصفت الأهداف لا يقل عن ثلاثة أنواع تمييزه سريريا لكن مختلفة وراثيا من مرض وراثي جسمي الشلل النصفي التشنجي النقي (ADPSP). في هذه الدراسة تمت دراسة الخصائص السريرية، وراثية، العصبية، والتصوير بالرنين المغناطيسي من ADPSP.
طرق ستين ثلاثة على أعضاء خطر من خمس أسر قيمت سريريا. وقد تم إنشاء مؤشر التشخيص للدراسة. تم تحديد المورثات الصغرية للصبغيات 2P، 14Q، وأجريت 15q علامات وتحليلات متعددة الربط. دراسات الساعة التوصيل المحرك المركزي (CMCT)، أثار الحسية الجسدية المحتملة (SSEP) القياس، وأجريت أشعة الرنين المغناطيسي للدماغ والحبل الشوكي الكلي في 16 مريضا من أربع أسر.
النتائج وأعرب عن الملامح الأساسية السريرية لADPSP متجانس في جميع المرضى ولكن تم العثور على بعض الميزات فقط في بعض العائلات وليس في جميع المرضى داخل الأسرة. في عائلتين غير تقدمية "خلقي" كان ينظر ADPSP في بعض أعضاء المتضررين في حين كان الكبار ADPSP تقدمية بداية موجودة في غيرها من أفراد الأسرة المصابين. كعرض الراحل كان المبلغ عنها وغير الموصوفة سابقا الظهر انخفاض بنسبة 47٪. العمر عند بداية تختلف على نطاق واسع، وكان هناك ميل إلى الانخفاض في الأجيال المتعاقبة في الأسر، مما يشير إلى الترقب. تحليل الربط الجيني تقتصر موضع ADPSP إلى الكروموسوم 2p21-P24 في الأسر الخمس. وكانت عشرات اللد التي تم الحصول عليها عن طريق تحليل متعددة الربط إيجابية مع أقصى درجة اللد مجتمعة Z = 8.60. وأظهرت الدراسات العصبية فقط إطالة طفيفة وضئيلة من الوقت التوصيل المحرك المركزي وكذلك أن التوصيل الطرفية وسلامة الأعمدة الظهرية كانت في معظمها طبيعية. لم الدماغ والحبل الشوكي مجموع MRI عدم الكشف عن أي تشوهات كبيرة مقارنة مع الضوابط.
الاستنتاجات ADPSP مرتبطة الكروموسوم 2p21-P24 هو اضطراب غير متجانسة المظهري تتميز كلا interfamilial والاختلاف داخل الأسرة. في بعض العائلات قد يكون المرض "نقية" ولكن اقترح وجود "نقية بالإضافة إلى" الأسر في مناطق أخرى. وقال إن التحقيقات العصبية والتصوير العصبي لا تظهر أي تشوهات كبيرة.
تضم paraplegias تشنجي وراثي مجموعة غير متجانسة من الاضطرابات العصبية النادرة. تقليديا تم تقسيمها إلى مجموعتين، وهذا يتوقف على ما إذا كان اضطراب هو الشلل النصفي التشنجي النقي أو متلازمة أكثر تعقيدا مع الميزات الأخرى المرتبطة بها. 1 وراثي جسمي الشلل النصفي التشنجي النقي (ADPSP) يتميز سريريا من قبل التشنج ببطء تدريجي وضعف في الساقين، فرط المنعكسات، وعلامة بابنسكي، بمشاركة ضئيلة أو معدومة من الأطراف العلوية؛ التعبير phenotypical من ADPSP يجري متغير بدرجة كبيرة، ولا سيما فيما يتعلق العمر عند بداية. من خلال الربط يحلل تم تعيينها ADPSP إلى الكروموسومات 14Q (موضع SPG3)، 2P (SPG4)، و15q (SPG6). 2-4 كما ADPSP في بعض الأسر لا تعين أي من هذه المكاني، الجينات لا تزال مجهولة الهوية إضافية قد الوجود. 5
تقتصر النتائج عصبية مرضية بشكل حصري تقريبا على الحبل الشوكي وتشمل انحطاط مساحات القشري الجانبي تناقص من انخفاض أسفل الظهر إلى مستوى عنق الرحم العلوي. في كثير من الأحيان، وكما وصفت مشاركة مساحات هرمي امتصالب وزيادة انحطاط الناحلة الحزمة من الفقرات القطنية إلى مستوى عنق الرحم العلوي. 6 وجزئيا انعكست هذه النتائج في النتائج اسريرية باستخدام التحفيز المغناطيسي أو الكهربائي عبر الجمجمة من القشرة الحركية، الحسية الجسدية أثار إمكانيات (SSEPs)، ودراسات التوصيل العصبي. 7-9 على الرغم من أن التصوير بالرنين المغناطيسي توفر صورا فائقة من جذع الدماغ، المخيخ، والنخاع الشوكي، إلا سلسلة صغيرة من المرضى الذين يعانون من ADPSP تم دراستها. 10 11 والغرض من هذه الورقة هو تقديم السريرية، اسريرية، والسمات الوراثية في كل من خمس عائلات مع ADPSP، ومناقشة interfamilial والاختلاف داخل الأسرة.
المرضى والطرق

المرضى

تم تفتيش Probands لفي السجلات من العيادة الخارجية العصبية في مستشفى هافيدوفر وفي معهد علم الوراثة الطبية في كوبنهاغن. بعد الموافقة المسبقة، وشوهد أفراد الأسرة في المنزل أو في المستشفى. تم التشخيص على أساس وجود تاريخ عائلي موثقة جيدا ومعايير التشخيص من هاردينغ 1 وبروين وScheltens. 12 وكانت معايير الحد الأدنى للتشخيص التشنج في الأطراف السفلية، عادة ما تكون أكثر وضوحا من الضعف، وردود الفعل وتر مفرط، وعلامة بابنسكي . وقد تم إنشاء مؤشر لتشخيص الدراسة (الجدول 1).

الجدول 1
مؤشر لتشخيص ADPSP

تم فحص ثلاث وستين شخصا من خمس أسر (المعين AE) شخصيا، باستثناء ثلاثة أشخاص من عائلة و(IV-10، V-7، V-8، التين 1)، الذين يعيشون في السويد. كل ثلاثة، ومع ذلك، تم الإبلاغ عن عدد من أفراد الأسرة أن تتأثر وأكد تاريخهم اتصال هاتفي. وقد تم تعيين الأشخاص الذين قد لقوا حتفهم كما تتأثر إذا قيل لهم كان "المرض الأسرة" بأكثر من واحد من أفراد الأسرة أو من خلال سجلات المستشفى. تم الحصول على عينات من الدم لعزل الحمض النووي.

الشكل 1
الأنساب من العائلات الخمس (AE) مع ADPSP. الأرقام المذكورة أعلاه رموز تشير العمر عند بداية.

A ثلاث نقاط على نطاق والدرجات الوظيفية، من تعديل بيهان ومايا اعتمد للدراسة. 13 درجة 1 يناظر المريض غير متناظرة مع وجود علامات الهرمية في الأطراف السفلية مع مشية عادية أو تشنجي فقط قليلا. الصف 2 يشير إلى المريض مع مشية تشنجية، وقادرة على المشي بشكل مستقل مع أو بدون دعم. الصف 3 يشير إلى chairbound أو مريض طريح الفراش.
وخضع خمسة مرضى من عائلة A، أربعة مرضى من العائلة B، أربعة مرضى من عائلة C، وثلاثة مرضى من عائلة D، بدءا من الصف 1-3 التحفيز المغناطيسي عبر الجمجمة والدراسات SSEP، والرنين المغناطيسي للدماغ والحبل الشوكي. لأسباب جغرافية كان المرضى من E الأسرة غير متوفر للدراسات اسريرية.
دراسات الربط الجينية

تم استخراج DNA الجينومية من الكريات البيض باستخدام إجراءات القياسية. تم تحديد المورثات الصغرية لSPG3، SPG4، وSPG6 مواضع. واحد من كل زوج التمهيدي ونهاية المسمى، وذلك باستخدام (γ- 32 P) ATP وكيناز عديد النوكليوتيد T4 (فارماسيا في مجال التكنولوجيا الحيوية).
وأجري تفاعل البلمرة المتسلسل (PCR) في نظام بيركن إلمر GeneAmp PCR 2400 باستخدام الشروط التي قدمها برجر وآخرون 14 مع تعديلات طفيفة: كانت التليين درجات الحرارة 59 درجة مئوية لمدة D2S400. 57 ° C لD14S266، D14S269، وD15S156. 55 ° C لD15S128 وD15S986.
تم احتساب الدرجات اللد عن طريق تحليل متعددة باستخدام برنامج LINKMAP من حزمة FASTLINK 15 مع علامات وضعه وفقا لخريطة Généthon. 16 وكانت علامات والمسافات (سم) المستخدمة لتحليل متعددة كروموسوم 2: D2S400- (0.0) - D2S352- (0.01) -D2S2351 - (0.01) - D2S2374 - (0.0) - D2S367. كروموسوم 14: D14S266- (6.0) -D14S269. كروموسوم 15: D15S128- (8.0) -D15S156.
تقنيات الكهربية

أجريت المركزي الساعة التوصيل السيارات (CMCT) القياسات على اليمين واليسار الخاطف القصيرة لإبهام اليد، العضلة ذات الرأسين العضدية، المتسعة الإنسية، عظام الساق الأمامية، باسطة القصيرة، والمبعدة لإبهام العضلات. وضعت القطب المشاركين في midpart من العضلات، وإشارة على القاصي وتر للتسجيل الكهربائي. تم تحديد عتبة السيارات كما أدنى كثافة التحفيز التي أعطت أثار لاستنساخه المغناطيسي المحتملة (MEP) مع اتساع تتجاوز 50 μV في خمسة المحفزات متتالية. طبقت التحفيز للمنطقة القشرية المقابل تمثل العضلات، على النحو المحدد في المنطقة مع عتبة أدنى المحرك. طبقت كل التحفيز مع استرخاء (غير سهل) العضلات. كانت كثافة التحفيز 1،5 × عتبة الحركية. طبقت تحفيز عنق الرحم وأسفل الظهر. تم قياس الكلية والرقبية القطنية الإختفاء وحسبت CMCTs.
وقد تم الحصول على SSEPs من تحفيز الأعصاب متوسط ​​اليسار واليمين في المعصم والأعصاب عظام الساق في الكعب الإنسي. وقد تم الحصول على SSEPs من الأعصاب متوسط ​​من وجهة Erbs، C7، من وإلى المنطقة التالية للتلم المركزي المقابل. سجلت SSEPs من الأعصاب عظام الساق من المنطقة الألوية، Th12، ومن المنطقة postvertex. كانت كثافة التحفيز نحو 50٪ أعلى من الحد الأدنى لانكماش مرئية للالقصيرة المبعدة لإبهام والمبعدة لإبهام العضلات. وقدمت تقريرا مفصلا للطريقة والبيانات المعيارية التي كتبها بيدرسن وTrojaborg. 17 وتمت مقارنة النتائج من جميع القياسات مع النتائج من الاصحاء مع التقدم في السن وارتفاع توزيعات مماثلة.
التصوير بالرنين المغناطيسي

أجريت الدماغ والحبل الشوكي MRI في 1.0 تسلا نظام فائق التوصيل (سيمنز الأثر). تم تصوير الدماغ باستخدام المحورية والاكليلية تدور مزدوج تسلسل صدى (مللي 2200/20/80 (الوقت التكرار (TR) / صدى الزمن (TE) / صدى الزمن (TE)))، والسهمي T1 المرجحة تدور الصور صدى (570 / 15 (TR / TE)). في النخاع الشوكي تم الحصول السهمي تدور مزدوجة الصور صدى (مللي 2200/20/80 (TR / TE / TE)) وT1 الصور المرجحة (500/15 (TR / TE)). تم إجراء التصوير بالرنين المغناطيسي مماثلة في ضوابط صحية مطابقة للعمر والجنس. اثنين من أطباء الأشعة خبرة تقييم الصور من المرضى والضوابط وذكرت بتوافق الآراء لعلامات أمراض. تم تقييم المخ، المخيخ، جذع الدماغ، والنخاع المستطيل وجود ضمور على نطاق والدرجات ثلاث نقاط (0: لا ضمور؛ 1: ضمور خفيف؛ 2: ضمور شديد). احصي الآفات Hyperintense على T2 الصور المرجحة وولوحظ أي علامة أخرى من الأمراض. تم تقييم النخاع الشوكي لوجود ضمور في T1 الصور المرجحة وفحص للآفات hyperintense على T2 الصور مرجح.
إحصائيات

وتمت مقارنة العمر في توزيعات الحدوث قبل اختبار كروسكال واليس والمتوسطات التي كتبها t الاختبار. تم فحص العلاقة بين CMCT والارتفاع عن طريق الانحدار الخطي. وتمت مقارنة الترددات χ 2 الاختبار. واتخذت مستوى الدلالة 0.05.

النتائج

كان ميراث السائد واضح من الأنساب (الشكل 1). لم يكن لوحظ انتفاذ غير مكتملة. في الفحص السريري من 63 شخصا، 30 استوفى معايير مؤشر ADPSP 3 (الجدول 2). وسجل اثني عشر شخصا من عائلات A، B، C، D و0-1، 1 أو 2، تسعة منهم ليس لديه أعراض، ولكن كشف علامات في الامتحان. وكان ثمانية عشر شخصا من دون أي أعراض أو علامات ADPSP (مؤشر ADPSP 0). في جميع المرضى كان بداية غدرا وتقتصر على الساقين.

الجدول 2
مؤشر التشخيص والعمر عند بداية ومدة المرض، ودرجة الإعاقة (متوسط، المدى) في خمس عائلات مع ADPSP

الجدول 2 يبين الأعمار في بداية في الأسر الخمس. سن بداية المتنوعة داخل وبين العائلات على حد سواء، إلا أن خمسة توزيع الأعمار في بداية لا تختلف كثيرا ووجدنا هناك فرق الجنس. لم نكن قادرين على تحديد وقت مبكر أو متأخر الأسر الظهور الموافق المعايير المقترحة من قبل هاردينغ، 18 فيما عدا أسرة B. التي قد تكون عائلة بداية مبكرة. تم العثور على ميزة وليس وصفها من قبل في الأسر A و E، التي كان خمسة أعضاء بداية الطفولة غير تقدمية في حين كان غيرهم من أفراد الأسرة المصابين المراهق التدريجي أو بداية البالغين. 32 أزواج الآباء والأبناء ومنهم من تضرر كل من الأم والطفل (مؤشر ADPSP 3)، وقعت بداية من ADPSP في العقد السابق من الحياة في الطفل مما كانت عليه في الأصل في 24 زوجا ("المجموعة تحسبا") وفي العقد نفسه أو في عقد لاحق في ثمانية أزواج (P <0.01). للقضاء على التحيز التثبت المباشر، تم استبعاد اثنين من أزواج الآباء والأبناء التي تضم مرضى مؤشر. من 30 زوجا المتبقية 22 كانوا في مجموعة الترقب وكان هذا لا يزال فائض كبير (P <0.02)، مما يشير إلى الترقب. وكان متوسط ​​العمر عند بداية للنسل في نقل الأب 20.6 عاما، وعلى نقل الأمهات 27.2 عاما ولكن الفرق لم يكن كبيرا. في كل خمس أسر كان المتوسط ​​لدرجة العجز 2 وهو ما يتفق مع المسار إلى حد ما "حميدة" من ADPSP. رجلين من الأسر C (II-3) وE (II-1)، مع تقدم العمر عند بدء في 40 و 41 عاما هم المرضى chairbound الوحيد. في كلتا الحالتين كان المرض التدريجي بسرعة مع مدة تسعة فقط و 12 عاما حتى تم يجمد فيها.
الجدول 3 يلخص توزيع المظاهر السريرية المحدد في 30 مريضا مع مؤشر ADPSP 3. جميع المرضى، باستثناء ثلاثة مع ظهور الأعراض من مرحلة الطفولة، وكان معالم السيارات العادية. وكانت الأعراض الأولية الأكثر شيوعا تصلب في الساقين (93٪)، تليها الأحذية السريعة البالية، وخاصة في الخارج في الجبهة (87٪)، وعدم الثبات بالمشي (87٪). كعرض أواخر أفيد انخفاض آلام الظهر بنسبة 47٪ من المرضى.

الجدول 3
الأعراض والعلامات في 30 من الأشخاص المتضررين (مؤشر ADPSP 3) في الأسر الخمس

لاختبار وجود ارتباط بين مدة المرض وحدوث ستة الخصائص السريرية تم تقسيم المرضى الذين يعانون من مؤشر ADPSP 3 إلى مجموعتين وفقا لما إذا كانت مدة المرض كان أكثر أو أقل من 10 عاما. حدث انخفاض آلام الظهر لأقل نسبيا المرضى إذا كانت مدة المرض كان أقل من 10 عاما مما لو كانت مدة أكثر من 10 سنة (2 من 7 = 29٪ ضد 12 من 23 = 52٪). أيضا لفرط المنعكسات العلوي أطرافه، وضعف في الساقين، وانخفاض الشعور الاهتزاز، والأعراض البولية، ورأرأة النسب كانت أقل لمجموعة من المرضى الذين يعانون من قصر مدة. ومع ذلك، ربما يرجع ذلك إلى أي مجموعات صغيرة من الاختلافات كانت كبيرة.
وقد تم الحصول على عشرات اللد إيجابية للعلامات SPG4 على الصبغي 2P مع أقصى درجة متعددة اللد للالجمع بين خمس عائلات من Z = 8.60 (لا تظهر البيانات).
يحلل الربط في مواضع ADPSP على الكروموسومات أظهرت 14Q و15q recombinations في كل واحد منهم في كل خمس أسر. لذلك النمط الظاهري من غير المرجح أن يكون سبب حدوث تحور في جين ينتمون إلى واحدة من تلك مواضع اثنين. وهكذا تحليل الربط تقتصر موضع ADPSP إلى الكروموسوم 2p21-P24 (SPG4) في كل من أسر خمسة.
في الفحص الكهربية كانت SSEPs وضعها الطبيعي في تحفيز الأعصاب الوسيطة في 15 من 16 مريضا. قدم أحد المريض إطالة طفيف في الوقت التوصيل المركزي. في تحفيز الأعصاب الظنبوب تم العثور على 11 من 16 وضعها الطبيعي. كانت تشوهات في خمسة مرضى بسيطة وتافهة، تقتصر في معظمها على الأطراف السفلية. الرسم البياني مبعثر في الشكل 2 يوضح CMCT في مللي تآمر ضد الارتفاع. لأصابع الباسطة القصير للقيم CMCT تميل إلى أن تكون أعلى للمرضى من لضوابط. لضوابط القيم CMCT زادت في المتوسط ​​مع ارتفاع. وقد لوحظ اتجاه مماثل للمرضى، ولكن الانحدار ليس كبيرا، وربما يعود ذلك إلى عدد قليل. بالنسبة للمرضى ويبدو أيضا أن النقاط المنتشرة إلى حد أكبر حول خط الانحدار مقارنة مع الضوابط. لم نعثر على أي خلافات بين العائلات الأربع وعدم وجود ارتباط بين السن عند بداية ومدة المرض، أي علامة واحدة، والنتائج العصبية.

الرقم 2
المركزي الساعة التوصيل السيارات (CMCT) ضد ارتفاع في 16 مريضا مع ADPSP والضوابط. مجلس التنمية الاقتصادية = باسطة القصيرة. APB = المبعدة لإبهام القصيرة. الدوائر شغل = المرضى. الدوائر المفتوحة = الضوابط. خطوط الانحدار (1) و (4) للمرضى، (2) و (3) لترد على الضوابط: (1) CMCT = -19.46 + 0.23 × الارتفاع. (2) CMCT = 2.20 + 0.08 × الارتفاع، (ن = 28)؛ (3) CMCT = 6.07 + 0.01 × الارتفاع، (ن = 50)؛ (4) CMCT = 1.64 + 0.04 × الارتفاع. كان معامل الانحدار 0.08 أكبر بكثير من 0 (P = 0.01).

التصوير بالرنين المغناطيسي كشف ضمور النخاع الشوكي معتدل في شقيقان من عائلة C؛ في المريض II-1 على مستوى ث 4-6 وII-7 على مستوى ث 3-7. ومع ذلك، أفيد هذه النتيجة عن طريق الأشعة واحد فقط. تم العثور على ضمور القشرية المعتدلة في مريض واحد من الأسرة D (II-10)، وكذلك في عنصر تحكم واحد، سواء كبار السن من 50 عاما. وشوهدت آفات النظر hyperintensity البيضاء في نصفي الكرة المخية في ستة مرضى من عائلات مختلفة أربعة، مقارنة مع شخصين في 15 الضوابط (6 من 16 = 38٪ ضد 2 من 15 = 13٪، والفرق ليس كبيرا). لم اجه المخيخ أو ضمور الدماغ.

نقاش

الربط تحليلات تقتصر موضع ADPSP في كل خمس أسر في الكروموسوم 2p21-P24. وبالتالي فإن الأسر تمثل واحدة ونفس النوع من ADPSP.
كان Interfamilial والاختلاف داخل الأسرة في سن بداية اضح. تذبذب داخل الأسر قد يعكس حقيقة أن العمر عند بداية قد يكون من الصعب للغاية حتى الآن على وجه التحديد، وخاصة في ADPSP، وهو اضطراب ببطء تدريجي، والتي الأعراض يمكن أن تمر مرور الكرام لسنوات كما يتضح من تسعة مرضى من بين 12 مع مؤشر ADPSP 0-1 و 1 و 2.
لم نجد قفزات جيل. وذكر انتفاذ غير مكتملة من قبل بولو وآخرون 19 ولكن كما ذكرت نسبة عالية من المرضى الذين يعانون أعراض في ADPSP يجعلها محفوفة بالمخاطر للنظر تتأثر كما سلف الذين لم يتم فحصها.
هذه الظاهرة من الترقب قد يكون نتيجة لتحيز تجنيد لصالح الأسر التي يتم اكتشاف المرض في وقت سابق من الأطفال مما كانت عليه في الآباء والأمهات على النحو الذي اقترحه Dürr ألف آخرون 11 أو ظاهرة بيولوجية كما هو مبين على الأقل في حالات "خلقي" ADPSP ينظر في الأسر ألف وهاء وغيرها جسمية الاعصاب اضطرابات يورث مثل مرض هنتنغتون، 20 ضمور dentatorubropallidoluysian، 21 وماتشادو يوسف المرض 22 حالة الترقب راسخة والناجم عن استطالة futher للتوسع CAG تكرار في الجينات المعنية.
مثل الدر وآخرون 11 لم نعثر على أي تحيز الوالدين ولكن كان هناك اتجاه نحو انخفاض سن بدء في النسل عندما أحيل جين المرض أبويا مقارنة مع انتقال الأمهات، الذي يوصف أيضا في علاج الاضطرابات العصبية الثلاث المذكورة أعلاه.
كان التباين المظهري واضح، على الرغم من أن المعالم الأساسية لADPSP وأعرب عن متجانس في جميع المرضى. ومع ذلك، وآلام الظهر منخفضة، لا ترتبط سابقا مع ADPSP، كان ينظر في كل خمس أسر، وربما هذا العرض قد يكون نتيجة للشاقة، مشية قعسي من هؤلاء المرضى. خلل تناوبية الحركات، قد تكون ذات صلة رأرأة، والتلفظ إلى الدماغ أو مشاركة المخيخ. ومع ذلك، وقعت تلك الميزات في أقلية من أعضاء المتضررين فقط، وليس في الآخرين من نفس العائلة وأبدا في probands. ولذلك، لا تزال مدرجة تلك الأسر في فئة ADPSP نقية وإصابات أجهزة متعددة، وفقا لتقييم البصرية، والدماغ، أثار الحسية الجسدية الإمكانات، وقد اقترحت الدراسات حركات العين رمشي من قبل الآخرين أيضا. 11 17 23 24
وربما يرجع ذلك إلى اختلافات في المعايير السريرية، في شدة ومدة المرض، والتباين الوراثي، واختلاف تشريحي، وتقنيات التسجيل أن الدراسات العصبية من ADPSP يتعارض نوعا ما، ومتضاربة. لدينا في SSEPs المواد من الأطراف العلوية كانت طبيعية في 15 من 16 مريضا وفقا للتوزيع أعراض وعلامات ADPSP ونتائج بروين وآخرون 25 من 11 من 16 مريضا كانوا SSEPs من الأطراف السفلية ضمن طبيعي مجموعة في حين أن التشوهات في خمسة مرضى كانت طفيفة وضئيلة فقط، وهو على النقيض من ذلك مع نتائج بروين وآخرون، الذين كتبوا عن الشاذ SSEPs عظام الساق العصبية في 20 من 32 مريضا مع ADPSP من تسعة الصلات الأسرية الميراث غير المبلغ عنه في مقابل واحد من 17 ضوابط.
في دراسة CMCT لدينا، التي يؤديها التحفيز المغناطيسي عبر الجمجمة، وكانت من أعضاء البرلمان الأوروبي الأطراف العلوية والسفلية فقط ضمن المعدل الطبيعي، وجدت لا يوجد فرق كبير، مقارنة مع الضوابط، وبين أو داخل الأسر. ومع ذلك، كان هناك ميل لتأخر البرلمان الأوروبي في الأطراف السفلية. في دراسة قام بها نويل وآخرون 7 تم فحص أربعة مرضى ADPSP مع تسجيلات من كل أطرافه العلوية والسفلية. كان لديهم القيم الطبيعية للتسجيلات الطرف العلوي في ثلاثة مرضى ولكن القيم غير طبيعي لأطرافه السفلى في جميع المرضى الأربعة. وثمة مشكلة رئيسية في معظم الدراسات السابقة، ومع ذلك، هو ما إذا كان يتم تطبيق التحفيز المغناطيسي عبر الجمجمة مع كثافة كافية لاستحضار MEP. تأخر أو أن ينظر أعضاء البرلمان الأوروبي غائبة في المرضى الذين يعانون من زيادة عتبة الحركية. في دراستنا لذلك طبقنا التحفيز المغناطيسي عبر الجمجمة مع كثافة المتعلقة عتبة الحركية ونتائجنا تشير إلى أن التوصيل في مسارات السيارات المركزية في معظم الحالات أمر طبيعي وأن إزالة الميالين في أول الخلايا العصبية الحركية ليست ظاهرة المرضية الرئيسية. ولذلك، فإننا نقترح أن آلية الشوكي المحلية قد تكون أيضا تشارك في التسبب في والتشنج.
في دراسة التصوير بالرنين المغناطيسي وصفت ضمور النخاع الشوكي الصدري في شقيقان ولكن فقط عن طريق الأشعة واحد. وهكذا يبدو أن ضمور النخاع الشوكي قد يكون من الصعب تقييم ويفترض أن إيجاد متأخر جدا كما تقييمها نوعيا من خلال التصوير بالرنين المغناطيسي. أيضا دراسة التصوير بالرنين المغناطيسي للمرضى من عائلة مع X مرتبطة النقي خزل سفلي تشنجي وراثي كشف الحبل الشوكي الطبيعي في المريض الوحيد الذي كان له الحبل الشوكي MRI تنفيذها. 26 MRI للمخ، المخيخ، وكان الدماغ العادي معظمها في مرضانا. Ormerod وآخرون 10 تقريرا عن سبعة مرضى الذين يعانون من مرض وراثي جسمي خزل سفلي تشنجي وراثي إما في شكل نقي (خمس حالات) أو مع ميزات إضافية الذي كان الرنين المغناطيسي للدماغ يقوم به. كان مريض واحد مع شكل نقي الآفات المسألة hyperintensity البيضاء في حين كان التصوير بالرنين المغناطيسي الطبيعي في أربعة مرضى آخرين مع ADPSP. وجدنا الآفات المسألة hyperintensity البيضاء في أقدم ستة مرضى ADPSP مقارنة مع اثنين من الضوابط وفقا للتقصي من زيادة خطية تقريبا في عدد من المتطوعين المصابين بآفات مسألة hyperintensity بيضاء مع الشيخوخة للرجال والنساء في دراسة التصوير بالرنين المغناطيسي من 142 صحي الناس كريستيانسن وآخرون 27
في الختام، الميزات الأساسية السريرية لADPSP مرتبطة أبديت متجانس في جميع المرضى الكروموسوم 2p21-P24 لكن تم العثور على بعض الأعراض والعلامات إلا في بعض الأسر وفقط في عدد قليل من المرضى من تلك الأسر، وهي ميزة في جزء قد تكون مسؤولة عن تعريف متفاوتة من ADPSP من دراسة إلى أخرى. وهكذا يبدو أن ADPSP قد يكون أكثر أو أقل "نقية"، وأنه "نقية زائد" قد توجد عائلات دون أن "معقدة"، ويفترض اعتمادا على حد سواء على طفرة معينة في الأسرة وعلى عوامل وراثية وبيئية غير معروفة تحوير كذلك. توقع، عمر متفاوتة في البداية، وعدم التجانس المظهري قد توحي بوجود تكرار ثلاثي النوكليوتيد غير مستقر كما الطفرة الجزيئية الكامنة، 28 ولكن المزيد من التحقيقات، بما في ذلك الدراسات الجينية الجزيئية، وسوف تكون هناك حاجة لتحديد الجينات المسؤولة ADPSP لتوضيح العمليات الفيزيولوجية المرضية والعمل على تسوية مسألة التصنيف.

شكر وتقدير

تم الحصول على دعم مالي من صندوق أبحاث الجمعية الطبية الدانماركية؛ مؤسسة مستشفى الدانماركية للبحوث الطبية، مقاطعة كوبنهاجن، جزر فارو، وغرينلاند. وسيغني وصندوق غريغرسن بطرس. صندوق لوند Benthine ليلى؛ واعترف الدكتور Eilif ترير هانسن وزوجته انو ترير هانسن صندوق الامتنان. أن هذه الدراسة لم يكن ممكنا من دون مشاركة من المرضى الذين يعانون من ADPSP وأسرهم.

المراجع

 

__________________
استشارى الادوية الطبيعيه وباحث وخبير فى علاجات التوحد
رد مع اقتباس
  #12  
قديم 11-22-2015, 10:38 PM
رافت ابراهيم رافت ابراهيم غير متواجد حالياً
عضو ذهبي
 
تاريخ التسجيل: Dec 2011
المشاركات: 520
افتراضي تكوين الوحدة الفرعية متغير والأنسجة محددة من الميتوكوندريا م -aaa البروتياز مجمعات ترتبط راثي مشلول الشلل النصفي

 

http://mcb.asm.org/content/27/2/758.full

البروتيني م -AAA، مجمع بروتين ATP التي تعتمد في الغشاء الداخلي الميتوكوندريا، يتحكم جودة البروتين وينظم التجمع الريبوسوم، وبالتالي ممارسة مهام التدبير المنزلي الأساسية داخل الميتوكوندريا. الطفرات في م -AAA البروتيني فرعية paraplegin تسبب انحطاط محور عصبي وراثي في الشلل النصفي التشنجي (HSP)، ولكن ليست مفهومة أساس لخصوصية الأنسجة غير متوقعة. Paraplegin يجمع مع مفارز Afg3l2 مثلي في المجمعات مغاير بلازميدة قليلة القسيمات التي يمكن أن تكون بديلا عن البروتياز الخميرة م -AAA، مما يدل على الحفظ وظيفية. وظيفة من paralogue الثالث، أعرب Afg3l1 في الماوس، غير معروف. هنا، نحن نحلل تجميع paraplegin إلى متر المجمعات -AAA ورصد الآثار المترتبة على نقص paraplegin في الخلايا الليفية HSP ونموذج الفأر لHSP. تكشف النتائج التي توصلنا إليها التغير في التجمع البروتياز م -AAA في الميتوكوندريا في الأنسجة المختلفة. يمكن تشكيلها Afg3l1 وAfg3l2 مجمعات للوطي بلازميدة قليلة القسيمات والمجالس-مغاير بلازميدة قليلة القسيمات كل من البروتينات مع paraplegin. وتبين الدراسات تكامل الخميرة النشاط بروتين من هذه التجمعات. نقص Paraplegin في HSP لا يؤدي إلى فقدان م -AAA نشاط الأنزيم البروتيني في الميتوكوندريا الدماغ. بدلا من ذلك، المجمعات Afg3l2-وطي بلازميدة قليلة القسيمات تتراكم، ويمكن لهذه المجمعات بديلا عن مهام تدبير الشؤون المنزلية م المجمعات -AAA التي تحتوي على paraplegin. لذا فإننا نقترح تشكيل م البروتياز -AAA مع خصوصيات الركيزة تغييرها يؤدي إلى انحطاط محور عصبي في HSP.

الميتوكوندريا هي عضيات الأساسية وتنوعا. وتؤوي تلك المجمعات الجهاز التنفسي المنتجة للطاقة وتمثل المكان الرئيسي لإنتاج الأكسجين التفاعلي المحمول، ولكنها تحمل أيضا ردود فعل الابتنائية حاسمة وظائف مهمة خلال العمليات أفكارك والإشارات الخلوية. كشفت المسوحات البروتين الميتوكوندريا المعزولة من أنسجة الثدييات المختلفة براعة كبيرة في تكوين البروتين من العضيات، والذي قد يعكس مختلف الاحتياجات الأيضية والمنشطة في خلايا مختلفة (14، 25). ونظرا لأهمية هذه العضيات لالفيزيولوجيا الخلوية، فإنه ليس من المستغرب أن الخلل الميتوكوندريا وقد تم ربط لمختلف الأمراض البشرية السائدة، بما في ذلك اضطرابات الاعصاب (9، 21، 34، 35). وقد تم تحديد الطفرات المسببة للأمراض في كل من البروتينات الميتوكوندريا الميتوكوندريا المشفرة والمشفرة النووية. ميزات مشتركة من اضطرابات الميتوكوندريا هي مجموعة متنوعة هائلة في شدة المرض وخصوصيات الأنسجة ملفتة للنظر. في حين أن هذا يمكن أن تكون على الأقل يفسر جزئيا heteroplasmy في حالة الطفرات الميتوكوندريا، وحاليا غير مفهومة عواقب الأنسجة محددة من الجينات المشفرة النووية المعيبة مع وظائف التدبير المنزلي.
ويتمثل ذلك من خلال استمارة مقهورة من الشلل النصفي التشنجي وراثي (HSP)، والذي كان سببه طفرات في paraplegin، وحدة فرعية من الحفظ ATP التي تعتمد م -AAA البروتيني في الغشاء الداخلي للميتوكوندريا (29). فقدان النتائج paraplegin في انحطاط محور عصبي من الخلايا العصبية الحركية القشرية، مما أدى إلى جمود وضعف في الأطراف السفلية (8). دراسات مع خميرة الخباز الخميرة المخصصة النشاط المزدوج إلى البروتيني م -AAA لتدهور البروتين وتفعيل (27): أنه تجري مراقبة نوعية البروتين في الغشاء الداخلي ويحط بروتينات الغشاء nonassembled لالببتيدات (4، 22)؛ من ناحية أخرى، فإنه يتوسط معالجة البروتين وبالتالي ينشط بروتينات معينة الميتوكوندريا. وتشمل ركائز التي المشقوق بدلا من التي تدهورت بفعل البروتيني م -AAA السيتوكروم ج الغلوثانيون (12) والوحيدات الريباسي MrpL32 (26). انشقاق MrpL32 من قبل البروتيني م -AAA يضمن تجميع الريباسي وتخليق البروتين داخل الميتوكوندريا وضروري للتنفس (وبالتالي 26).
مثل كل مفارز المعروف البروتياز AAA، paraplegin ينتمي إلى الفصيلة AAA من ATPases ويتميز بوجود وحدة AAA أتباز الحفظ (15). على الرغم من تورطه في أنشطة الخلوية المتنوعة، وهي سمة مشتركة من البروتينات AAA هو أنها تنشط على التجمع هومو أو مغاير بلازميدة قليلة القسيمات فقط. ويفسر هذا من خلال تفعيل النشاط أتباز عن طريق التواصل بين المجالات بين المجالات المجاورة AAA (18، 28). وفقا لذلك، والبروتيني الخميرة م -AAA يشكل مجمع مغاير بلازميدة قليلة القسيمات مبنية من مثلي Yta10 (Afg3) وYta12 (Rca1) مفارز؛ هو المعطل المجمع في غياب فرعية واحدة (4). البروتينات مثلي لYta10 وYta12 موجودة بتواجد مطلق في الخلايا حقيقية النواة متعددة الخلايا (17)، ولكن من المفهوم وظيفة الثدييات البروتياز م -AAA سيئة فقط. وكشفت الدراسات تكامل حفظ الوظيفي للم البروتياز -AAA في الخميرة والثدييات وحددت مجموعة معقدة من paraplegin الثدييات وAfg3l2 (لAFG3 تشبه الجين 2) كما orthologue ظيفية من الخميرة م -AAA البروتيني (5، 26). نموذج الفأر لHSP تفتقر paraplegin يعيد الميزات الهامة من الأمراض التي تصيب البشر ويكشف التدريجي وخلية محددة تنكس محواري في الهابطة طويلة والصعود مساحات في العمود الفقري، في الأعصاب البصرية، والأعصاب الوركي (13). ميزات عصبية مرضية والأدلة التجريبية تشير إلى أن تنكس محور عصبي يرجع في النهاية إلى نقل محور عصبي ضعف. ومع ذلك، واحدة من العلامات الأولى للأمراض هو مظهر من الميتوكوندريا العملاقة وغير طبيعي من الناحية الهيكلية في المناطق البعيدة من المحاور، مما يدل على أن ضعف الميتوكوندريا محددة العصبية يطلق شلال المرضية (13). استنساخ النمط الظاهري الإنسان في نموذج الفأر لافت للنظر باعتبار أن ونديد إضافية من paraplegin، Afg3l1 (لAFG3 تشبه جينات 1)، موجود في الفأرة ولكن المشفرة من قبل جين كاذب في البشر (20).
عواقب الأنسجة محددة من فقدان paraplegin محيرة، وظائف التدبير المنزلي الحاسمة من البروتيني م -AAA، مثل تجهيز الوحيدات الريباسي MrpL32، يتم حفظها من الخميرة للثدييات (27). ومن المتوقع أن يؤدي إلى عيوب في الفسفرة التأكسدية نضوج ضعاف من MrpL32 في الميتوكوندريا الثدييات. ومع ذلك، في حين أن أوجه القصور في التجمع من مجمع لقد تم الإبلاغ عن HSP الليفية المريض (5)، لوحظت فقط العيوب تنفسية خفيفة في الأنسجة الماوس paraplegin ناقصة (13). في الآونة الأخيرة، وقد تم ربط paraplegin لتجهيز بروتين من OPA1 (16)، وهي تشبه dynamin GTPase المحفوظة في الغشاء الداخلي الذي ينظم ديناميات الميتوكوندريا (10). الطفرات في OPA1 سبب وراثي جسمي ضمور العصب البصري المهيمن تتميز خسارة في خلايا الشبكية (1، 11). كما الموسع والميتوكوندريا غير طبيعية تتراكم في المراحل المبكرة في المحاور في Spg7 - / - الفئران (13) ويلاحظ ضمور العصب البصري وأحيانا في أشكال معقدة من HSP وفي نموذج paraplegin الماوس (8، 13)، قد يتم تجهيز OPA1 ضعف من أهمية المسببة للأمراض.
للحصول على مزيد من الإيضاحات بشأن العواقب المترتبة على فقدان paraplegin، في هذه الدراسة، قمنا بتحليل تجميع المفترضة م مفارز -AAA البروتيني في الفئران والإنسان الميتوكوندريا. ونحن لشرح الاختلافات الأنسجة محددة في الوفرة النسبية للم مفارز -AAA البروتيني في الماوس وتقلب غير متوقع في جمعيتهم. وتشكل كل من Afg3l1 وAfg3l2 مجمعات للوطي بلازميدة قليلة القسيمات وكذلك المجالس-مغاير بلازميدة قليلة القسيمات التي تحتوي على paraplegin. وتشير دراساتنا أن الجمعية تغير من مفارز مثلي بدلا من فقدان كامل للم -AAA نشاط الأنزيم البروتيني ذو أهمية المسببة للأمراض في HSP.
المواد والأساليب

استنساخ الإجراءات على سبيل التعبير في الخميرة، وتنصهر في شكل ناضج من الفئران Afg3l1 (الأحماض الأمينية 25-789) إلى الميتوكوندريا استهداف تسلسل Yta10 (الأحماض الأمينية 1-61). تم استنساخ A جزء HindIII / BamHI DNA التي تحتوي على مروج YTA10 (480 بي بي) وبي بي 1-183 من YTA10 وجزء BamHI / KpnI DNA التي تحتوي على بي بي 73-2367 من Afg3l1 إلى البلازميد YEplac195 multicopy. وعلقت A حاتمة ج. Myc على لمحطة C من Afg3l1 للسماح للمناعي من البروتين الهجين Yta10 (1-61) -Afg3l1 (25-789) -Myc. البلازميدات الخميرة السماح تعبير مغايرة من AFG3L2 البشرية (hAFG3L2) -Myc (في YEplac112 ADH1)، الفئران Afg3l2-هيماغلوتينين (في YEplac112 YTA10)، وparaplegin (في YEplac181 YTA10) والبلازميدات pGEM4-Atp7 وpGEM4-Yme2ΔC لSP6-البلمرة وقد وصفت التعبير -driven في المختبر سابقا (5، 19، 26).
تم المعطل م -AAA مفارز البروتيني من استبدال بقايا الغلوتامات ناشطة تحفيزيا داخل مراكز بروتين مع بقايا الجلوتامين باستخدام QuikChange موقع الموجه عدة الطفرات (Stratagene). وقد تبدل الكودونات منها على النحو التالي: أكاديمية الخليج للطيران إلى الجهاز المركزي للمحاسبات عن hAFG3L2 (الأحماض الأمينية 575) والفئران Afg3l2 (الأحماض الأمينية 574) وGAG لCAG لparaplegin الفئران (الأحماض الأمينية 575) وAfg3l1 (الأحماض الأمينية 567). استخدمت [أليغنوكليوتيد التالية: 5'-GGT CGC CTT CCA TCA GTC TGG CCA TGC C-3 "(التمهيدي إلى الأمام) و5'-GGC ATG دول مجلس التعاون الخليجي AGA CTG ATG غا GGC GAC C-3" (التمهيدي العكسي) لparaplegin الفئران ؛ 5'-CTG TAG CCT ACC ACC AGG CTG GGC ATG CAG-3 "(التمهيدي إلى الأمام) و5'-CTG CAT دول مجلس التعاون الخليجي CAG CCT GGT GGT AGG CTA CAG-3" (التمهيدي العكسي) لالفئران Afg3l1. و5'-CGG TGG CTT ACC ACC AAG CAG دول مجلس التعاون الخليجي ATG CGG-3 "(التمهيدي إلى الأمام) و5'-CCG CAT GGC CTG CTT GGT GGT AAG CCA CCG-3" (التمهيدي العكسي) لالفئران Afg3l2. تم التحقق من الطفرات من تسلسل الحمض النووي.

سلالات الخميرة وظروف النمو. سلالات خميرة الخباز المستخدمة في هذه الدراسة هي مشتقات من W303. تم الحصول على yta10 Δ yta12 Δ (YKO200) سلالة من حذف YTA12 في Δ yta10 (YGS101 [3]) سلالة بواسطة PCR تستهدف إعادة التركيب مثلي باستخدام الحذف كاسيت kanMX6 (23). yta10 Δ yta12 Δ سلالات التعبير عن الإنسان أو تم إنشاء البروتياز الفئران م -AAA (انظر الجدول S1 في المواد التكميلية) من خلال التحول من YKO200 الخلايا مع البلازميدات YEplac112 ADH1 -Yta10 (1-61) -hAFG3L2 (36-798) -Myc، YEplac181 YTA10 -Yta10 (1 -61) -paraplegin (44-781)، YEplac195 YTA10 -Yta10 (1-61) -Afg3l1 (25-789) -Myc، وYEplac112 YTA10 -Yta10 (1-61) -Afg3l2 (36-802) -HA أو البلازميدات ترميز المتغيرات موقع بروتين منها (5، 26).
كانت تزرع خلايا الخميرة وفقا للاجراءات المتبعة عند 30 درجة مئوية في أي من الخميرة، ببتون المتوسط ​​أو الحد الأدنى من المتوسط ​​تستكمل مع auxotrophs المطلوبة. اثنين في المئة (وزن / المجلد) الجلوكوز، أو لعزل الميتوكوندريا، 2٪ (وزن / المجلد) اللبن و 0.5٪ (وزن / المجلد) اللاكتات، أو لفحص نمو الجهاز التنفسي، أضيفت 3٪ (وزن / المجلد) الجلسرين كما مصادر الكربون.

تم تنفيذ BN-PAGE. الأزرق الأصلي الكهربائي هلام بولي أكريلاميد (BN-PAGE) أساسا كما هو موضح سابقا (30). تم solubilized بروتينات الميتوكوندريا (150 ميكروغرام) المعزولة من الخميرة أو الخلايا الليفية الأولية الإنسان بتركيز 5 ملغ / مل في 1٪ (وزن / المجلد) ديجيتونين، 30 ملي تريس، حمض الهيدروكلوريك، ودرجة الحموضة 7.4، 4 ملي المغنيسيوم خلات، 5 ملي ε-جذر الأمينو ن حمض -caproic، 50 ملي كلوريد الصوديوم، 1 ملم ATP. بعد زيادة ونقصان توضيح لمدة 30 دقيقة في 125،000 × ز، تم تحميل مقتطفات الصعود إلى 3-13٪ (وزن / المجلد) هلام بولي أكريلاميد. تم الكشف عن مفارز الفردية المجمعات البروتيني م -AAA التي كتبها immunoblotting.

تم solubilized تحليل الترشيح هلام مقتطفات الميتوكوندريا. الميتوكوندريا الخميرة المعزولة التي تحتوي على hAFG3L2 أو hAFG3L2 E575Q (البروتين 1 ملغ الميتوكوندريا) بتركيز 5 ملغ / مل في 1٪ (وزن / المجلد) ديجيتونين، 30 ملي تريس، حمض الهيدروكلوريك، ودرجة الحموضة 7.4، 4 ملي المغنيسيوم خلات، 150 ملي K-خلات، ودرجة الحموضة 7.4، 1 ملم phenylmethylsulfonyl الفلورايد (PMSF)، 1 ملي ATP. وهي lysed الفئران (1 ملغ الميتوكوندريا البروتين) بتركيز 5 ملغ / مل في 2٪ (وزن / المجلد) ديجيتونين، 50 ملي كلوريد الصوديوم، عازلة 50 ملي K-الفوسفات، ودرجة الحموضة 7.0، 4 مم - الميتوكوندريا الكبد من Spg7 - / MG-خلات، 10٪ (وزن / المجلد) الجلسرين، 1 ملم EDTA، 1 ملم PMSF. تمت إزالة المواد Nonsolubilized بواسطة الطرد المركزي لمدة 30 دقيقة في 125،000 × ز، وتعرض طاف لاستبعاد حجم اللوني باستخدام عمود Superose 6. تم جمع البروتينات مزال في الكسور 500 ميكرولتر، حمض ثلاثي كلور أسيتيك (TCA) عجل، وتحليلها بواسطة سلفات الصوديوم دوديسيل (SDS) -PAGE وimmunoblotting. وتم قياس كمية البروتينات الموجودة في الكسور شطافة التي كتبها كثافة الليزر.

تقرير من الوفرة النسبية للم -AAA مفارز البروتيني. لمقارنة كميات النسبية paraplegin، Afg3l1، وAfg3l2 في الكبد والدماغ الميتوكوندريا، وقد تم تحليل المستخلصات الميتوكوندريا التي كتبها SDS-PAGE وimmunoblotting. كانت مجزأة مقتطفات تحتوي على كميات مماثلة من Afg3l1 بواسطة SDS-PAGE وتحليلها بواسطة immunoblotting باستخدام Afg3l1-، paraplegin-، والأجسام المضادة Afg3l2 محددة و، من أجل السيطرة، الأجسام المضادة الموجهة ضد الوحيدات 70 كيلو دالتون من نازعة سكسينات (Sdha). وتم قياس كمية البروتين كميات باستخدام نظام التصوير القائم على مضان (أوديسي؛ LI-COR العلوم البيولوجية). تم تطبيع إشارات لAfg3l2 وparaplegin باستخدام Afg3l1 كعنصر تحكم التحميل. تم احتساب الكمية النسبية للparaplegin وAfg3l2 في الكبد والدماغ الميتوكوندريا كنسبة من إشاراتها في كل التحضيرات الميتوكوندريا.

Coimmunoprecipitation وimmunodepletion على سبيل التجارب مناعي، وهي lysed الميتوكوندريا الفئران (400 ميكروغرام الميتوكوندريا البروتين) بتركيز 1 ملغ / مل في 2٪ (وزن / المجلد) ديجيتونين، عازلة 50 ملي K-الفوسفات، ودرجة الحموضة 7.0، 50 ملي كلوريد الصوديوم، 4 ملي المغنيسيوم خلات، 10٪ (وزن / المجلد) الجلسرين، 1 ملم PMSF تستكمل مع كوكتيل مثبط البروتياز (روش). بعد زيادة ونقصان توضيح لمدة 15 دقيقة في 125،000 × ز، تم تحميلها مقتطفات على البروتين الخرز-A سيفاروز (2 ملغ) إلى جانب الأجسام المضادة تنقية تقارب أو مصل preimmune والمحتضنة لمدة 12 ساعة عند 4 درجات مئوية تحت الهز لطيف. وكانت تغسل حبات في وقت لاحق مع 0.5٪ (وزن / المجلد) ديجيتونين، عازلة 50 ملي K-الفوسفات، ودرجة الحموضة 7.0، 50 ملي كلوريد الصوديوم، 4 ملي المغنيسيوم خلات، 1 ملم PMSF، 10 ملي تريس، حمض الهيدروكلوريك، ودرجة الحموضة 7.4. ومزال المجمعات الضد مستضد من الخرز ومجزأة على أساس للا مائية وذلك باستخدام 1٪ (وزن / المجلد) تريتون-X114 و 1٪ (المجلد / المجلد) حمض الخليك. تم انتشال البروتينات مزال من الكسر المنظفات التي كتبها TCA هطول الأمطار وتحليلها بواسطة SDS-PAGE وimmunoblotting.
وأجريت التجارب Immunodepletion باستخدام كميات تشبع من Afg3l2 أو الأجسام المضادة Afg3l1C بالإضافة إلى البروتين الخرز-A سيفاروز (10 ملغ). وهي lysed الميتوكوندريا (150 ميكروغرام البروتين الميتوكوندريا) بتركيز 0.5 ملغ / مل في 2٪ (وزن / المجلد) ديجيتونين، عازلة 50 ملي K-الفوسفات، ودرجة الحموضة 7.0، 50 ملي كلوريد الصوديوم، عازلة 50 ملي K-الفوسفات، ودرجة الحموضة 7.0 ، 4 ملي المغنيسيوم خلات، 10٪ (وزن / المجلد) الجلسرين، 1 ملم PMSF تستكمل مع كوكتيل مثبط البروتياز (روش) وتطبيقها على البروتين الخرز جانب الضد-A سيفاروز. أجريت الأمطار خارج كما هو موضح أعلاه. تعرض خمسين في المئة من الكسر طاف من هطول الأمطار (الموافق 75 ميكروغرام الميتوكوندريا البروتين) لهطول الأمطار TCA، SDS-PAGE، وimmunoblotting.

وأثيرت الأجسام المضادة. الأجسام المضادة الموجهة ضد متر -AAA مفارز البروتيني في الأرانب (BioGenes، ألمانيا) باستخدام الببتيدات الموافق الأحماض الأمينية 121-139 من paraplegin الفئران (C-PEDDEEEKRRKEREDQMYR)، إلى الأحماض الأمينية 90-103 من Afg3l2 (C-KEAVGEKKEPQPSG ) والأحماض الأمينية 104-118 (C-NAGPGGDGGNRGGKG) أو الأحماض الأمينية 771-785 (C-WNKGREEGGTERGLQ) من Afg3l1 (Afg3l1 وAfg3l1C، على التوالي) المناعي النوعي غس الدولية المختصة بالسلع وتنقيته من الأمصال التي كتبها immunoabsorption على الببتيد، مترافق SulfoLink مصفوفة (بيرس) واختباره من قبل immunoblotting ومناعي من الميتوكوندريا yta10 Δ Δ yta12 الخميرة التي تحتوي إما paraplegin، Afg3l1 أو Afg3l2. تم التحقق من خصوصية Afg3l1 وAfg3l2 أمصال مضادة أيضا باستخدام شظايا البروتين الذي يحتوي على مناطق المستضدات المقابلة أعرب في القولونية.
تم استخدام الأجسام المضادة وحيدة النسيلة المتاحة تجاريا للمناعي من الوحيدات 39 كيلو دالتون من مجمع I (Ndufa9؛ المسابر الجزيئية)، الوحيدات 70 كيلو دالتون من نازعة سكسينات (Sdha؛ المسابر الجزيئية)، ج. Myc على (9B11؛ خلية اشارة التكنولوجيا )، والحواتم هيماغلوتينين (3F10؛ روش).

. متنوعة تم تنفيذ الإجراءات التالية أساسا كما هو موضح سابقا: عزل الميتوكوندريا من الخميرة، والخلايا الليفية الإنسان، والأنسجة الفئران (6، 24، 33)؛ توليف preproteins الميتوكوندريا رديولبلد. posttranslational استيراد البروتين في الميتوكوندريا المعزولة. والتحلل البروتيني من البروتينات المستوردة حديثا (33).

النتائج

مجمع hAFG3L2-وطي بلازميدة قليلة القسيمات في الميتوكوندريا الإنسان. Paraplegin وhAFG3L2 مفارز تجميع في الغشاء الداخلي للميتوكوندريا البشري إلى نشطة وظيفيا البروتيني م -AAA التي كون تشكيلها هو ضعف في خلايا المريض HSP تفتقر paraplegin (5). والمثير للدهشة، تم الكشف عن مجمع عالية الجزيئية الكتلة تحتوي على hAFG3L2 عندما تم solubilized الميتوكوندريا المعزولة من-paraplegin نقص الخلايا الليفية HSP في ديجيتونين وتحليلها بواسطة BN-PAGE. وكانت الكتلة الجزيئية لهذا المجمع ~900 كيلو دالتون ومماثلة لتلك التي للمغاير بلازميدة قليلة القسيمات م -AAA البروتيني تحتوي على hAFG3L2 وparaplegin موجودة في البرية من نوع البشري الميتوكوندريا (الشكل 1A).

تين. 1.
hAFG3L2 يشكل م -AAA مجمع البروتيني-وطي بلازميدة قليلة القسيمات مع نشاط بروتين. (A) مجمع hAFG3L2-وطي بلازميدة قليلة القسيمات في الميتوكوندريا المعزولة من الخلايا الليفية HSP. تم solubilized الميتوكوندريا في ديجيتونين وتحليلها بواسطة SDS-PAGE (50 ميكروغرام الميتوكوندريا البروتين، اللوحة العليا) أو BN-PAGE (150 ميكروغرام الميتوكوندريا البروتين، اللوحة السفلى)، تليها immunoblotting باستخدام paraplegin محددة (اللوحة العليا) وhAFG3L2 محددة ( العلوي والسفلي لوحة) أمصال مضادة. من أجل السيطرة، كانت مجزأة الخميرة yta10 Δ Δ yta12 تحتوي على hAFG3L2 الميتوكوندريا التي كتبها BN-PAGE بشكل متواز. واستخدمت ثايروجلوبولين (669 كيلو دالتون) وصميم الفريتين (443 كيلو دالتون) للمعايرة. (B) صيانة نمو الجهاز التنفسي من yta10 Δ Δ yta12 خلايا الخميرة التي كتبها hAFG3L2. البرية من نوع (WT) الخلايا، yta10 Δ yta12 Δ الخلايا، وyta10 Δ yta12 Δ الخلايا معربا عن hAFG3L2 أو البديل غير نشط proteolytically hAFG3L2 E575Q (hAFG3L2 EQ)، وقد نمت على تخمر (خلاصة الخميرة، ببتون-سكر العنب [YPD]) و nonfermentable (وسائل الإعلام التي تحتوي على الجلسرين [YPG]) مصادر الكربون في 30 ° C. (C) المجمعات hAFG3L2-هومو بلازميدة قليلة القسيمات في yta10 Δ الميتوكوندريا yta12 Δ. وأعرب عن hAFG3L2 أو hAFG3L2 E575Q (hAFG3L2 EQ) في الخلايا Δ Δ yta10 yta12، وتم عزل الميتوكوندريا. بعد الإذابة في المخزن التي تحتوي على ديجيتونين، كانت مجزأة مقتطفات الميتوكوندريا (1 ملغ الميتوكوندريا البروتين) من خلال Superose 6 التحجيم اللوني. وكسور شطافة TCA عجل وتحليلها بواسطة SDS-PAGE وimmunoblotting باستخدام الأجسام المضادة hAFG3L2 محددة. وكان كميا hAFG3L2 (المربعات شغل) أو hAFG3L2 E575Q (الدوائر شغل) موجودة في الكسور شطافة التي كتبها كثافة الليزر، ويتم إعطاء النتائج كنسبة مئوية من البروتين منها في شطافة الإجمالية. مجمع أصغر hAFG3L2 التي تحتوي على، وضع علامة مع علامة النجمة، أكثر النتائج المحتملة من التفكك الجزئي للمجمع كبير. تم استخدام البروتينات علامة التالية للمعايرة: 1، Hsp60 (840 كيلو دالتون)؛ 2، صميم الفريتين (443 كيلو دالتون)؛ 3، نازعة الكحول (150 كيلو دالتون)؛ 4 البقري albumine المصل (66 كيلو دالتون). (D و E) تجهيز MrpL32 الخميرة وCCP1 التي كتبها hAFG3L2. تم تحليل معالجة البروتين في البرية من نوع (WT) الخلايا، yta10 Δ Δ yta12 الخلايا، وyta10 Δ Δ yta12 الخلايا معربا إما hAFG3L2 أو hAFG3L2 E575Q (hAFG3L2 EQ) بواسطة SDS-PAGE. تم رصد (D) نضوج MrpL32 (L32) في الميتوكوندريا المعزولة (30 ميكروغرام البروتين الميتوكوندريا) من خلال immunoblotting باستخدام أمصال مضادة بولكلونل موجهة ضد ناضجة وأشكال السلائف من MrpL32 و، ​​كما تحكم التحميل، ضد المترجمة مصفوفة Mge1. تم فحص معالجة (E) CCP1 في مقتطفات الخلية باستخدام أمصال مضادة موجهة ضد CCP1 و، من أجل السيطرة، وبروتين الغشاء الخارجي Tom40. ص، السلائف. م، شكل ناضج. (F) تدهور للبروتينات غشاء nonassembled التي كتبها hAFG3L2 أعرب في الخميرة. تم استيرادها رديولبلد Yme2ΔC (اللوحة العليا) أو Atp7 (اللوحة السفلى) لمدة 10 دقيقة في درجة حرارة 25 مئوية في الميتوكوندريا المعزولة من سلالات الخميرة المستخدمة لوحات D و E. استقرار البروتينات المستوردة حديثا في 37 ° C تم تحديدها من قبل SDS- PAGE وتصوير الإشعاع الذاتي. يظهر بمعدل ثلاث تجارب مستقلة (± الخطأ المعياري للمتوسط). الساحات شغلها، النوع البري. مثلثات شغلها، yta10 Δ Δ yta12. مثلثات مفتوحة، yta10 Δ Δ yta12 + hAFG3L2. الساحات المفتوحة، yta10 Δ Δ yta12 + hAFG3L2 E575Q.

لدراسة ما إذا كانت hAFG3L2 يجمع مع AAA البروتيني فرعية أخرى أو يشكل مجمع وطي بلازميدة قليلة القسيمات في الغشاء الداخلي، عبرنا عن البروتين في خلايا الخميرة yta10 Δ Δ yta12 تفتقر إلى أي الوحيدات م -AAA البروتيني. تم عزل الميتوكوندريا من هذه الخلايا وsolubilized في ديجيتونين، وتم تحديد الكتلة الجزيئية الأم من hAFG3L2 بواسطة BN-PAGE (الشكل 1A). تم الكشف عن hAFG3L2 كجزء من مجمع ~900 كيلو دالتون، وبالتالي يشكل مجمع مماثلة في الحجم لأنه في الميتوكوندريا-paraplegin ناقصة الإنسان. وتشير هذه النتائج إلى أن hAFG3L2 يمكن بناء مجمع وطي بلازميدة قليلة القسيمات في الغشاء الداخلي للميتوكوندريا.
التعبير عن hAFG3L2 استعادة حدها اختصاص الجهاز التنفسي من yta10 Δ خلايا yta12 Δ (الشكل 1B). هذه الملاحظة هي على النقيض من النتائج التي توصلنا إليها السابقة باستخدام م -AAA البروتيني نقص الخميرة سلالة أخرى وعلى الأرجح تعكس الاختلافات سلالة محددة (5). لتقييم اعتماد النمو التنفسي على التحلل البروتيني من قبل hAFG3L2، استبدلنا بقايا الغلوتامات ناشطة تحفيزيا 575 قبل الجلوتامين، وأعرب عن البروتين الطافر في yta10 Δ خلايا yta12 Δ. لم تحور أن تؤثر على تجميع hAFG3L2 إلى مجمع عالية الجزيئية الكتلة كما يتبين من هلام تحليل ترشيح-ديجيتونين solubilized الميتوكوندريا (الشكل 1C). ومع ذلك، كان نمو الخلايا التي تحتوي على الجلسرين المتوسطة يلغى كليا، مما يدل على الاعتماد من التنفس على نشاط بروتين من hAFG3L2 (الشكل 1B).

التحلل البروتيني من قبل المجمعات hAFG3L2-وطي بلازميدة قليلة القسيمات. لمراقبة مباشرة التحلل البروتيني من قبل hAFG3L2، درسنا تجهيز اثنين preproteins الميتوكوندريا المشفرة النووية، وهي intermembrane البروتين الفضاء السيتوكروم ج الغلوثانيون (CCP1) والوحيدات الريباسي MrpL32، وكلاهما معروف ل أن المشقوق من الخميرة م -AAA البروتيني (12، 26). مطلوب نضوج MrpL32 لتجميع الريبوسوم، وبالتالي تخليق البروتين داخل الميتوكوندريا، وهو شرط أساسي لتجميع المجمعات الجهاز التنفسي في الغشاء الداخلي (26). بالاتفاق مع الظواهر وحظ نمو، والتعبير عن hAfg3l2 ولكن ليس hAfg3l2 E575Q في yta10 Δ Δ استعادة خلايا yta12 إلى حد كبير تجهيز MrpL32، كما يتضح من التحليل الغربي لطخة من الميتوكوندريا المعزولة من هذه الخلايا (الشكل 1D). وبالمثل، ناضجة CCP1 المتراكمة في خلايا yta10 Δ Δ yta12 إيواء hAfg3l2 ولكن ليس في وجود hAfg3l2 E575Q (الشكل 1E).
بالإضافة إلى دورها لمعالجة البروتين، والخميرة م جودة البروتين ضوابط -AAA البروتيني في الغشاء الداخلي وتتوسط تدهور كامل للبروتينات الغشاء غير الأصليين (4، 22). لدراسة ما إذا كان مجمع hAFG3L2 يمكن أيضا بديلا لهذا النشاط، تم توليفها اثنين من البروتينات الركيزة معروف من الخميرة م -AAA البروتيني في نظام خالية من الخلايا في وجود [35 S] ميثيونين واستيرادها إلى عزل yta10 Δ Δ yta12 الميتوكوندريا إيواء hAFG3L2 أو hAfg3l2 E575Q. واحدة من هذه الركائز، Yme2ΔC، المترجمة في الغشاء الداخلي ويحتوي على نطاق تتعرض لمصفوفة (22). حذف مجال الفضاء intermembrane-كربوكسي المحطة، موجودة في البرية من نوع Yme2، والنتائج في زعزعة استقرار Yme2ΔC وتدهور لاحق من م -AAA البروتيني (الشكل 1F) (19). حين تتراكم في yta10 Δ Δ yta12 الميتوكوندريا، وقد تدهورت المستوردة حديثا Yme2ΔC بحضور hAFG3L2 (الشكل 1F). في المقابل، بقي Yme2ΔC مستقرة في yta10 Δ Δ yta12 الميتوكوندريا إيواء hAfg3l2 E575Q. وقد لوحظت آثار مماثلة من خلال تحليل استقرار المستوردة حديثا Atp7، وهو الطرفية بروتين الغشاء الداخلي التي تدهورت بفعل م -AAA البروتيني وآخر، كما ولكن في ذات مجهولة الهوية البروتيني الميتوكوندريا (الشكل 1F) (19). في حين hAFG3L2 يسرع تدهور Atp7 في yta10 Δ Δ yta12 الميتوكوندريا، طفرة نقطة في المركز بروتين من hAFG3L2 (hAfg3l2 E575Q) ألغيت تماما هذا النشاط (الشكل 1F).
لذا نستنتج أن مجمع hAFG3L2-وطي بلازميدة قليلة القسيمات يمارس النشاط بروتين في الميتوكوندريا ويمكن أن تكون بديلا عن وظيفة الخميرة م -AAA البروتيني في تصنيع البروتين وتدهور للبروتينات غشاء nonassembled. وهكذا، hAFG3L2 تنشط proteolytically على حد سواء على التجمع مع paraplegin في مجمع مغاير بلازميدة قليلة القسيمات وعلى وطي oligomerization.

البروتياز م -AAA-مغاير بلازميدة قليلة القسيمات في الميتوكوندريا الفئران. وكشفت هذه التجارب التباين في جمعية الإنسان م -AAA البروتيني فرعية hAFG3L2. آخر المفترضة م -AAA البروتيني الوحيدات، Afg3l1، يتم ترميز من قبل جين كاذب في الإنسان ولكنه أعرب عن الماوس في إشارة إلى تقلب حتى أعلى في الأخير (20). الفئران Afg3l1 وAfg3l2 تبادل الهوية تسلسل 68٪، مما يشير إلى أنشطة مماثلة من كل من البروتينات. ومع ذلك، لم يتم تحليل وظيفة أو تجميع Afg3l1.
من أجل دراسة تركيبة معقدة من الإنزيمات البروتينية م -AAA في الميتوكوندريا الفئران، أجريت التجارب coimmunoprecipitation بها. رفعنا الأجسام المضادة الببتيد محددة موجهة ضد المفترضة مفارز م -AAA البروتيني Afg3l1، Afg3l2، وparaplegin. تم عزل الميتوكوندريا من الكبد الفئران، والنظر في النمط الظاهري الخلايا العصبية محددة من HSP، وأيضا من الدماغ. بعد الإذابة الميتوكوندريا في ديجيتونين، وحضنت مقتطفات مع أمصال مضادة-تنقية تقارب موجهة ضد متر -AAA مفارز البروتيني ثلاثة المفترضة. وقد تم تحليل الرواسب في وقت لاحق من قبل immunoblotting (الشكل 2). تم الكشف عن Paraplegin، Afg3l1، وAfg3l2 في immunoprecipitates بغض النظر عن الأجسام المضادة المستخدمة لهطول الأمطار (الشكل 2A). في المقابل، كان عجلت أيا من هذه البروتينات مع المصل preimmune، مما يدل على خصوصية التفاعل الملاحظة. وتم الحصول على نتائج مماثلة باستخدام الكبد أو الدماغ الميتوكوندريا (الشكل 2B). لذا نستنتج أن Afg3l1 يتفاعل مباشرة مع paraplegin وAfg3l2 في كل من الكبد والدماغ الميتوكوندريا. في اتفاق مع هذه النتائج، تم الكشف عن البروتينات في مجمع عالية الجزيئية الكتلة وcoeluted من العمود على تجزئة مقتطفات الميتوكوندريا التي كتبها التحجيم اللوني (لا تظهر البيانات).

تين. 2.
جمعية paraplegin، Afg3l1، وAfg3l2 في الميتوكوندريا الفئران. الميتوكوندريا (400 ميكروغرام الميتوكوندريا البروتين) تم عزل من (A) الكبد و (B) الدماغ وsolubilized مع ديجيتونين. تمت إزالة عشرة (الكبد) أو 20٪ (المخ) من العينة من أجل السيطرة (المدخلات). أجريت Coimmunoprecipitations من استخدام منقى تقارب paraplegin-، Afg3l1-، والأجسام المضادة Afg3l2 محددة. تم استخدام مصل Preimmune كوسيلة لمراقبة سلبية. وقد تم تحليل Immunoprecipitates (IP) من خلال SDS-PAGE وimmunoblotting.

م التجمع -AAA البروتيني في نموذج الفأر paraplegin ناقصة لHSP لرصد النتائج المترتبة على فقدان paraplegin على تشكيل الفئران المجمعات م -AAA الأنزيم البروتيني، درسنا تجميع Afg3l1 وAfg3l2 في الميتوكوندريا من Spg7 - / - الفئران. تم عزل الميتوكوندريا من الكبد والدماغ، solubilized في ديجيتونين، وتعرض لcoimmunoprecipitation باستخدام Afg3l2 محددة الأجسام المضادة تنقية تقارب والمصل preimmune (الشكل 3). وقد عجلت Afg3l1 مع Afg3l2 ولكن ليس مع المصل preimmune عندما مقتطفات من المنظفات Spg7 - / - تم تحليل الكبد أو الدماغ الميتوكوندريا (الشكل 3A وباء). باستمرار، اكتشفت جل التجارب الترشيح Afg3l1 وAfg3l2 كجزء من مجمع عالية الجزيئية الكتلة في الغشاء الداخلي للSpg7 - / - الميتوكوندريا الكبد (الشكل 3C). وهكذا، فإن فقدان paraplegin لا يمنع الجمعية من Afg3l1 وAfg3l2 في الغشاء الداخلي الميتوكوندريا. وتشير هذه النتائج إلى التقلبات في التجمع من الفئران م البروتياز -AAA التي يبدو أن تعتمد إلى حد كبير على توافر مفارز الفردية.

تين. 3.
مجمع Afg3l1 / Afg3l2-مغاير بلازميدة قليلة القسيمات في الميتوكوندريا من Spg7 - / - الفئران. مقتطفات ديجيتونين الميتوكوندريا (400 ميكروغرام البروتين الميتوكوندريا) من (A) الكبد و (B) في الدماغ من النوع البري (WT) وparaplegin ناقصة Spg7 - / - تعرض الفئران لcoimmunoprecipitations باستخدام الأجسام المضادة Afg3l2 محددة، تنقية تقارب كما وصفها في وسيلة إيضاح الشكل 2. تم استخدام المصل Preimmune كوسيلة لمراقبة سلبية. وقد تم تحليل الرواسب التي كتبها SDS-PAGE وimmunoblotting باستخدام paraplegin-، Afg3l1-، والأجسام المضادة Afg3l2 محددة. مبالغ Afg3l1 في الرواسب المستمدة من النوع البري وSpg7 - / - الميتوكوندريا تختلف قليلا في تجارب مختلفة. (C) مجمع عالية الجزيئية الكتلة تحتوي على Afg3l1 وAfg3l2 في Spg7 - / - الميتوكوندريا. مقتطفات (1 ملغم بروتين الميتوكوندريا) الميتوكوندريا الكبد معزولة عن Spg7 - / - كانت مجزأة الفئران عن طريق Superose 6 التحجيم اللوني. وكسور شطافة TCA عجل وتحليلها بواسطة SDS-PAGE وimmunoblotting باستخدام Afg3l1- والأجسام المضادة Afg3l2 محددة. وتم قياس كمية Afg3l1 (مثلثات شغل) وAfg3l2 (الدوائر شغل) في شطافة التي كتبها كثافة الليزر وتعطى كنسبة مئوية من البروتين منها في شطافة الإجمالية. علامات نجمية مجمع عالية الجزيئية كتلة من Afg3l1 وAfg3l2 التي coelutes مع prohibitins Phb1 وprohibitins Phb1 وPhb2، مما يدل على تفاعل م -AAA مجمع البروتيني مع prohibitins، كما لوحظ في الميتوكوندريا الخميرة (31). تم استخدام البروتينات علامة التالية للمعايرة: 1، مثنوي ATP سينسيز (1.5 MDA)؛ 2، أحادى ATP سينسيز (750 كيلو دالتون)؛ 3، صميم الفريتين (443 كيلو دالتون)؛ 4، نازعة الكحول (150 كيلو دالتون).

الاختلافات الأنسجة محددة في الوفرة النسبية للم -AAA مفارز البروتيني. وفي سياق هذه التجارب، لاحظنا أن مستويات ثابتة للدولة من م -AAA مفارز البروتيني يبدو أن تختلف في الكبد والدماغ الميتوكوندريا. استبعاد التأثيرات غير المباشرة بسبب الاختلافات في نقاء الاستعدادات organellar من الأنسجة المختلفة، قارنا الوفرة النسبية للAfg3l1، Afg3l2، وparaplegin في الميتوكوندريا المعزولة من الكبد والدماغ.تم تحديد مستويات ثابتة للدولة النسبية Afg3l2 وparaplegin من قبل immunoblotting مقتطفات الميتوكوندريا التي تحتوي على كميات متساوية من Afg3l1 (الشكل 4A). لافت للنظر، Afg3l2 المتراكمة في ~10-أضعاف أعلى المستويات في الدماغ مما كانت عليه في الكبد (الشكل 4A). كان Paraplegin أيضا أكثر وفرة في الدماغ مما كانت عليه في الميتوكوندريا الكبد وكان حاضرا عند مستويات ~4-أضعاف العالي في العضيات المعزولة من الدماغ الفئران (الشكل 4A). في المقابل، كان Afg3l1 الحاضر في انخفاض طفيف فقط المبالغ في الميتوكوندريا الدماغ قريبة الوحيدات 70 كيلو دالتون من سكسينات نازعة (الشكل 4A).

تين. 4.
الوفرة النسبية للparaplegin، Afg3l1 وAfg3l2 في الكبد والدماغ الميتوكوندريا. تم عزل الميتوكوندريا من (A) من النوع البري أو (B) Spg7 - / - كبد الفئران والدماغ. وقد تم تحليل المستخلصات التي تحتوي على كميات متساوية من Afg3l1 بواسطة الأجسام المضادة SDS-PAGE وimmunoblotting باستخدام paraplegin-، Afg3l1-، وAfg3l2 محددة فضلا عن الأجسام المضادة وحيدة النسيلة الموجهة ضد الوحيدات 70 كيلو دالتون من نازعة سكسينات (Sdha). وتم قياس كمية Paraplegin وAfg3l2 موجودة في الكبد والدماغ الميتوكوندريا بواسطة التصوير القائم على مضان باستخدام Afg3l1 كعنصر تحكم التحميل. تم احتساب نسبة إشارات الكشف عن Afg3l2 وparaplegin في الدماغ مقابل الميتوكوندريا الكبد لمراقبة الوفرة النسبية للم -AAA مفارز البروتيني في كل الأنسجة. متوسط ​​ن وأظهرت تجارب مستقلة (± الخطأ المعياري للمتوسط) باستخدام الأنسجة المعزولة من مختلف الحيوانات اختيارها عشوائيا.

فمن المتصور أن الوفرة النسبية للAfg3l1 وAfg3l2 يتم تبديل في غياب paraplegin، مما يؤدي إلى تعويض جزئي عن فقدان paraplegin. وبالتالي فإننا مقارنة الوفرة النسبية للAfg3l1 وAfg3l2 في الميتوكوندريا المعزولة من الكبد والدماغ من Spg7 - / - الفئران التي تفتقر paraplegin (الشكل 4B). عندما تطبيع Afg3l1، Afg3l2 لا يزال المتراكمة في-أعلى ~10 أضعاف المستويات في الميتوكوندريا الدماغ من Spg7 - / - الفئران، مما يدل على أن الوفرة النسبية لكل من البروتينات لم تتغير في غياب paraplegin.
هذه التجارب تكشف عن اختلافات لم تكن متوقعة في الوفرة النسبية للم مفارز البروتيني -AAA في الأنسجة المختلفة. وبالنظر إلى التباين الملاحظ في جمعيتهم، يبدو من المرجح أن تكوين فرعية من المجمعات بروتين يختلف بطريقة الأنسجة محددة.

هومو ومغاير بلازميدة قليلة القسيمات م البروتياز -AAA في الميتوكوندريا الدماغ. لتقييم تجميع م -AAA مفارز البروتيني بطريقة أكثر الكمية، أجرينا تجارب immunodepletion. تم solubilized الميتوكوندريا الدماغ في ديجيتونين، وكانت تستخدم الأجسام المضادة Afg3l2 محددة، تنقية تقارب في استنزاف تماما مستخلص Afg3l2 (الشكل 5A). كان Afg3l2 مناعيا لا يمكن كشفها في جزء طاف بعد immunodepletion. كانت تصاحب Afg3l2، Afg3l1 وparaplegin الحالي عند مستويات فقط تضاءلت بشكل كبير (الشكل 5A). حضانة مقتطفات الميتوكوندريا مع المصل preimmune أثرت على مستوى الدولة المستقرة من لا Afg3l2 ولا Afg3l1 أو paraplegin (الشكل 5A). لذا نستنتج أن Afg3l1، Afg3l2، وparaplegin تجميع الكمية مع بعضها البعض في الغشاء الداخلي للميتوكوندريا الدماغ.

تين. 5.
تعايش م البروتياز -AAA المبنية من مفارز مختلفة في الميتوكوندريا الدماغ. الميتوكوندريا (150 ميكروغرام البروتين الميتوكوندريا) من (A) من النوع البري (WT) و (B) Spg7 - / - وهي lysed الدماغ في ديجيتونين وحضنت مع تشبع كميات من المصل preimmune أو تنقية تقارب-Afg3l2- أو الأجسام المضادة Afg3l1C محددة. بعد إزالة راسب، وقد تم تحليل الكسور طاف (SN) بواسطة SDS-PAGE وفحصها لوجود paraplegin، Afg3l1، وAfg3l2 التي كتبها immunoblotting. تم استخدام الأجسام المضادة وحيدة النسيلة الموجهة ضد الوحيدات 39 كيلو دالتون من مجمع I (Ndufa9) للسيطرة على قدم المساواة هلام التحميل. في حين Afg3l1 وAfg3l2 يمكن أن تنفد تماما من الكسر طاف باستخدام الأجسام المضادة Afg3l1- أو Afg3l2 محددة، تنقية تقارب، على التوالي، لا يمكن أن تستنفد مقتطفات من paraplegin باستخدام الأجسام المضادة paraplegin محددة المتاحة (لا تظهر البيانات).

والجدير بالذكر، عندما أجريت تجارب مماثلة مع الأجسام المضادة Afg3l1 محددة، Afg3l2 وparaplegin تم استنفاد إلا قليلا من مقتطفات الميتوكوندريا. هذا الأرجح أن ذلك يعكس وفرة انخفضت من Afg3l1 مقارنة بما كان عليه من Afg3l2 وparaplegin. وهكذا، على الأقل مختلفة م المجمعات البروتيني -AAA تتعايش في الميتوكوندريا الدماغ: Afg3l2 / paraplegin والمجمعات Afg3l1 أقل وفرة التي تحتوي أيضا Afg3l2، paraplegin، أو كليهما.
التي متر -AAA البروتيني المجمعات موجودة في الميتوكوندريا الدماغ paraplegin ناقصة؟ لمعالجة هذه المسألة، ونحن عزل الميتوكوندريا الدماغ من Spg7 - / - الفئران وتحليلها وتكوين معقد من م المجمعات -AAA البروتيني من قبل immunodepletion باستخدام Afg3l1- والأجسام المضادة Afg3l2 محددة (الشكل 5B). على غرار البرية من نوع الميتوكوندريا، وAfg3l1 المنضب بالكامل تقريبا من مقتطفات من Spg7 - / - الميتوكوندريا الدماغ مع الأجسام المضادة Afg3l2 يدل التجمع الكمي (الشكل 5B). في المقابل، كان مستوى ثابت للدولة من Afg3l2 لا يكاد يتأثر المستنفدة Afg3l1 (الشكل 5B). نستنتج أن Afg3l2 هي موجودة في الزائدة بالنسبة لAfg3l1 في الميتوكوندريا الدماغ من النوع البري وSpg7 - / - الفئران. بينما Afg3l1 تجميعها كميا مع Afg3l2، فإن غالبية Afg3l2 ليست جزءا من هذا الهيكل وعلى الأرجح تشكل مجمعا وطي بلازميدة قليلة القسيمات.

النشاط بروتين من هومو ومغاير بلازميدة قليلة القسيمات م البروتياز -AAA. هذه التجارب تثبت وجود م -AAA المجمعات البروتيني مع تكوين الوحيدات متغير في الميتوكوندريا الفئران. لدراسة النشاط بروتين للجمعيات مختلفة، أجرينا دراسات تكامل مع م -AAA البروتيني-ناقص yta10 Δ yta12 خلايا Δ الخميرة.
في التجارب الأولية، paraplegin، Afg3l1، وAfg3l2 وأعرب بشكل مستقل في yta10 Δ yta12 Δ الخلايا وتم فحص نمو الخلايا في الجهاز التنفسي (الشكل 6A). لافت للنظر، والتعبير عن إما Afg3l1 أو Afg3l2 ولكن ليس paraplegin استعادة نمو yta10 Δ yta12 خلايا Δ على المحتوية على الجلسرين المتوسطة (الشكل 6A). هذا يذكرنا hAFG3L2، والتي شكلت-وطي بلازميدة قليلة القسيمات، proteolytically مجمعات نشاطا عندما أعرب في الخميرة (الشكل 1). تحليل الترشيح هلام مقتطفات الميتوكوندريا كشف الحقيقة وطي oligomerization من Afg3l1 وAfg3l2 في الخميرة، في حين paraplegin لا تشكل مجمع عالية الجزيئية الكتلة في غياب الأخرى مفارز AAA البروتيني (لا تظهر البيانات). التعبير عن المتغيرات موقع بروتين من Afg3l1 (Afg3l1 E567Q) أو Afg3l2 (Afg3l2 E574Q لم) لا تعزز نمو الجهاز التنفسي من yta10 Δ yta12 خلايا Δ، مشيرا إلى أن المجمعات وطي بلازميدة قليلة القسيمات تمارس النشاط بروتين (الشكل 6A). باستمرار، لاحظنا نضوج MrpL32 في yta10 Δ yta12 خلايا Δ إيواء Afg3l1 أو Afg3l2، في حين تم إلغاء هذا النشاط عن طريق الطفرات في مركز بروتين من كل من البروتين (الشكل 6B). وعلاوة على ذلك، تم استعادة تجهيز CCP1 على التعبير عن Afg3l1 أو Afg3l2 لكن إعاقة إلى حد كبير في وجود متغيرات الخاملة proteolytically من كل من البروتين (الشكل 6C). وتجدر الإشارة إلى أن نقص التنفسي من yta10 Δ yta12 خلايا Δ لم ترد على التعبير عن paraplegin، كما لم تنضج MrpL32 أو CCP1 الحاضر في هذه الخلايا (الشكل 6). وهكذا، تظهر القدرة على تكوين مجمعات للوطي بلازميدة قليلة القسيمات أن يقتصر على Afg3l1 وAfg3l2.

تين. 6.
النشاط بروتين من هومو-بلازميدة قليلة القسيمات ومغاير بلازميدة قليلة القسيمات م المجمعات -AAA البروتيني في الخميرة. (A) نمو الجهاز التنفسي من yta10 Δ yta12 خلايا Δ معربا عن الفئران م مفارز -AAA البروتيني. البرية من نوع (WT) الخلايا، yta10 Δ yta12 Δ الخلايا، وyta10 Δ yta12 Δ الخلايا معربا إما paraplegin، Afg3l1 (Afg3lX)، Afg3l2 (Afg3lX)، أو متحولة من المتغيرات Afg3l1 E567Q أو Afg3l2 E574Q (Afg3lX EQ كانت تزرع) في 30 ° C على (YPG) وسائل الاعلام (YPD) أو التي تحتوي على الجلسرين التي تحتوي على الجلوكوز لفحص كفاءة الجهاز التنفسي من الخلايا. لتقييم نشاط المجمعات مغاير بلازميدة قليلة القسيمات، متحولة المتغيرات Afg3l1 E567Q أو Afg3l2 E574Q تم coexpressed مع paraplegin (الفقرة / Afg3lX EQ) أو مع paraplegin E575Q (الفقرة EQ / Afg3lX EQ) في yta10 Δ yta12 تم تحليل Δ الخلايا والخلايا النمو على النحو الوارد أعلاه. (B و C) تجهيز MrpL32 الخميرة وCCP1 من قبل الفئران م البروتياز -AAA. تم تحليل معالجة البروتين في yta10 Δ yta12 خلايا Δ إيواء الفئران م -AAA مفارز البروتيني بواسطة SDS-PAGE كما هو موضح لوحة ألف وimmunoblotting كما هو موضح في أسطورة عن الشكل 1 باستخدام MrpL32 (L32) أمصال مضادة -specific (B) أو أمصال مضادة CCP1 محددة (C). ص، أشكال السلائف. م، أشكال ناضجة. استخدمت Mge1 وTom40 للسيطرة على قدم المساواة هلام التحميل.

في مزيد من التجارب، ونشاط بروتين من الفئران-مغاير بلازميدة قليلة القسيمات م تم تقييم البروتياز -AAA تتألف من Afg3l1 وparaplegin أو من Afg3l2 وparaplegin في الخميرة. بعد coexpression إما زوج من مفارز، تم التحقق من التفاعل من خلال التجارب coimmunoprecipitation (لا تظهر البيانات). على غرار الخلايا التي تحتوي فقط Afg3l1 أو Afg3l2، ونمو الجهاز التنفسي من yta10 Δ yta12 خلايا Δ تم ترميمه إذا كان coexpressed paraplegin مع أي البروتين (لا تظهر البيانات). لدراسة ما إذا كان هذا النمط الظاهري هو بسبب مغاير oligomerization مع paraplegin بدلا من هومو-oligomerization من Afg3l1 أو Afg3l2، على التوالي، عبرنا عن proteolytically المتغيرات غير نشطة من هذه البروتينات. الدراسات السابقة على الخميرة م وقد أثبتت -AAA البروتيني أن البروتيني هو المعطل فقط عندما تحمل جميع مفارز الطفرات نقطة في المركز بروتين بها (3). في المقابل، مجمع AAA البروتيني-مغاير بلازميدة قليلة القسيمات تتألف من وحدات فرعية النشطة وغير النشطة proteolytically يتوسط معالجة البروتين ويحافظ على نمو الجهاز التنفسي (3). في حين لا التعبير عن paraplegin ولا أن من Afg3l1 E567Q يسمح yta10 Δ yta12 Δ الخلايا لتنمو على المحتوية على الجلسرين المتوسطة، تم استعادة نمو الخلايا في الجهاز التنفسي على coexpression كل من البروتينات (الشكل 6A). في المقابل، yta10 Δ yta12 Δ الخلايا معربا عن خاملة proteolytically Afg3l1 E567Q وparaplegin E575Q كانت بالقصور التنفسي. وبالتالي، يمكن الحفاظ على نمو الجهاز التنفسي عن طريق مجمع / paraplegin نشط proteolytically Afg3l1.
لتقييم مباشرة النشاط بروتين من Afg3l1 مجمع / paraplegin-مغاير بلازميدة قليلة القسيمات، تم رصد نضوج CCP1 وMrpL32 في هذه الخلايا (الشكل 6B وC). تم الكشف عن أشكال ناضجة من كلا CCP1 وMrpL32 في الخلايا إيواء paraplegin وAfg3l1 E567Q ولكن ليس في وجود paraplegin E575Q وAfg3l1 E567Q. لذا نستنتج أن مجمع AAA البروتيني تتألف من Afg3l1 وparaplegin مفارز نشط proteolytically.
والجدير بالذكر، تم الحصول على نتائج مشابهة جدا عندما yta10 Δ yta12 Δ تم تحليل الخلايا معربا عن Afg3l2 وparaplegin (الشكل 6). إدخال طفرة نقطة في المركز بروتين من Afg3l2 (Afg3l2 E574Q) لم يلغ نمو الجهاز التنفسي إذا تم coexpressed paraplegin. وعلاوة على ذلك، تم تجهيز CCP1 وMrpL32 جزئيا في هذه الخلايا. على coexpression من Afg3l2 E574Q وparaplegin E575Q، ومع ذلك، لم ترد اختصاص الجهاز التنفسي من الخلايا، وكلا CCP1 وMrpL32 المتراكمة في شكل السلائف (الشكل 6). وهكذا، فإن مجمع / paraplegin Afg3l2 يمارس النشاط في بروتين الخميرة.

 

__________________
استشارى الادوية الطبيعيه وباحث وخبير فى علاجات التوحد
رد مع اقتباس
  #13  
قديم 11-22-2015, 10:44 PM
رافت ابراهيم رافت ابراهيم غير متواجد حالياً
عضو ذهبي
 
تاريخ التسجيل: Dec 2011
المشاركات: 520
افتراضي راثي شلل سفلي تشنجي المتنحية (SPG30) مع ترنح معتدل والاعتلال العصبي الحسي الخرائط لكروموسوم 2q37.3

 

http://brain.oxfordjournals.org/content/129/6/1456.full



الملخص

وparaplegias تشنجي وراثي (شركائنا HSPs) هي مجموعة سريريا وغير متجانسة وراثيا من الأمراض العصبية التي تتميز التشنج التدريجي في الأطراف السفلية. تم تعيين تسعة وعشرين مواضع مختلفة (SPG) حتى الآن، وتم تحديد 11 جينات مسؤولة. سريريا، واحد يميز بين أشكال HSP نقية والمعقدة التي ترتبط بنسب مختلفة مع مجموعات عديدة من علامات العصبية وخارج عصبية. لا يعرف الكثير عن أشكال مقهورة (ARHSP) منذ تم تحديد مواضع تعيينها في كثير من الأحيان في الأسر وحيدة وحساب نسبة صغيرة فقط من المرضى. نفيدكم موضعا ARHSP الجديد (SPG30) على الصبغي 2q37.3 في عائلة الأقارب مع سبعة تتأثر وأربعة أعضاء المتضررين من أصل المعيشة الجزائرية في شرق فرنسا بنتيجة كبيرة من 3.8 متعددة اللد. عشر عائلات أخرى من فرنسا = 4)، تونس = 2)، الجزائر = 3) وجمهورية التشيك = 1) لم تكن مرتبطة بموضع التي تم تشخيصها حديثا مما يدل على مزيد من التجانس الوراثي. النمط الظاهري للأسرة مرتبطة يتكون من خزل سفلي تشنجي واعتلال الأعصاب المحيطية المرتبطة مع وجود علامات للدماغ طفيفة أكده ضمور المخيخ على واحد الاشعة المقطعية.
  • SPG30
  • كروموسوم 2q37.3
  • راثي شلل سفلي تشنجي المتنحية
  • صلة
مقدمة

وparaplegias تشنجي وراثي (شركائنا HSPs) هي مجموعة سريريا وغير متجانسة وراثيا من الأمراض العصبية التي تتميز التشنج التدريجي في الأطراف السفلية. طريقة الميراث قد يكون وراثي جسمي، راثي مقهور (ARHSP) أو X-ربط. تم تعيين تسعة وعشرين مواضع مختلفة (SPG) حتى الآن، وحددت 11 الجينات المسؤولة. وغالبا ما تشارك البروتينات المناظرة في الاتجار محور عصبي أو استقلاب الميتوكوندريا (ريد، 2003).
سريريا، واحد يميز بين الأشكال نقية ومعقدة من HSP (الدر وبرايس، 2000؛ Tallaksen وآخرون، 2001.). في أشكال نقية، تتكون المظاهر السريرية من علامات هرمي معزولة، مثل ردود الفعل سريعة، بابينسكي علامة، التشنج والعجز الحركي، والتي يمكن أن تترافق مع اضطرابات العضلة العاصرة وفقدان الحواس عميقة. في أشكال معقدة من HSP، ويرتبط هذا المرض بنسب مختلفة مع مجموعات عديدة من علامات العصبية وخارج العصبية مثل رنح مخيخي، التلفظ، والتخلف العقلي، والاعتلال العصبي المحيطي، ضمور العصب البصري، التهاب الشبكية الصباغي، وفقدان السمع أو رقيقة الجسم الثفني.
وأوضح ما يقرب من 40٪ من الحالات الغالبة من مواضع معروفة. لا يعرف الكثير عن ARHSP منذ تم تحديد مواضع تعيينها في عدد قليل، واحدة في كثير من الأحيان، والأسر، وتمثل سوى نسبة صغيرة من المرضى. عادة ما يرتبط ARHSP مع الظواهر المعقدة سريريا ولكنها تعتبر SPG5، SPG24 وSPG28 أن تكون أشكال نقية من المرض (Bouslam وآخرون، 2005.؛. هودجكينسون وآخرون، 2002؛ ماير وآخرون، 2004... ويلكنسون وآخرون، 2003).
في هذه الدراسة فإننا الإبلاغ عن مكان ARHSP جديد على الصبغي 2q37.3 في عائلة الأقارب من أصل جزائري.

المرضى والطرق

المرضى

تم اختيار أحد عشر أسر مع ARHSP (ثمانية مع شكل نقي وثلاثة مع شكل معقد من ARHSP). وكان من بينهم 64 أشخاص، 27 منهم المتضررة. بعد موافقة مكتوبة، تم فحص جميع الأفراد من قبل طبيب أعصاب. استخدمت الخرائط موحدة لتقييم السريرية لجميع المشاركين. عائلة جزائرية (FSP-546؛ الشكل 1)، مع سبعة تتأثر وأربعة أعضاء المتضررين، أدرج في المسح على نطاق الجينوم. عشر عائلات أخرى نشأت من فرنسا = 4)، تونس = 2)، الجزائر = 3) وجمهورية التشيك = 1).

تين. 1
نسب الأسرة FSP-546. وأظهرت إعادة الإعمار النمط الفرداني لمدة تسع الواسمات الوراثية تمتد ~13 سم على كروموسوم 2. وبالنظر إلى الأرقام شفرة جميع أفراد العينة تحت حرف. الدوائر المغلقة (النساء) والساحات (الرجال) إلى أعضاء المتضررين. ويحيط النمط الفرداني متماثل يفترض أن تحمل أليل المرض عن طريق صناديق مغلقة. ميغابايت = megabase. سم = سنتي مورغان.

تم استخراج DNA من عينات الدم باستخدام بروتوكول قياسي. الطفرات في الجين SPG7 (paraplegin) (Casari وآخرون، 1998 تم استبعاد) في المرضى مؤشر من جميع الأسر التي كتبها dHPLC الفرز (Elleuch وآخرون، 2006).
التنميط الجيني

وتضخمت الواسمات الوراثية مع الاشعال الفلورسنت وشظايا حلها على ABI-3730 المنظم (النظم البيولوجية التطبيقية، فوستر سيتي، كاليفورنيا، الولايات المتحدة الأمريكية). تم تحديد الأنماط الجينية مع البرنامج GeneMapper 3.5 (النظم البيولوجية التطبيقية).
تم إجراء مسح الجينوم على نطاق الأسرة في FSP-546 باستخدام 400 الصغرية متباعدة ~10 سم (centimorgans) على حدة على جميع الكروموسومات. أجريت البشرى وتحليلات متعددة الربط باستخدام فاست لينك 3.0 (كوتينغام وآخرون، 1993) واليجرو البرامج 1.2c (Gudbjartsson وآخرون، 2000). واعتبر هذا المرض أن يكون توغل تماما جسمية مقهورة، مع تردد أليل مرض 0.00005 وتكافؤ الكسور إعادة التركيب للذكور والإناث. كانت المسافات الوراثية تلك من مركز مرشفيلد لعلم الوراثة الطبية وتم التحقق منها مواقف الخريطة على مشروع تسلسل الجينوم البشري (مراكز NCBI وEnsembl).
تحليل مرشح الجينات

وقد تم التسلسل المباشر لجميع الإكسونات الترميز، ومواقع لصق مجانحة وعلى الأقل 50 سنة مضت من تسلسل intronic على كل جانب من الجين STK25 باستخدام فاصل الكيمياء BigDye على المنظم ABI-3730 (النظم البيولوجية التطبيقية). وقد تم تحليل الشخصية اللوني باستخدام Seqscape 2.5 برنامج (النظم البيولوجية التطبيقية). متوفرة عند الطلب الاشعال PCR والشروط الصلب.

النتائج

رسم خرائط SPG30

بعد استبعاد الربط إلى عدة مواضع معروفة لARHSP (SPG5، SPG11، SPG21، SPG24، SPG27، SPG28) والتصلب الوحشي الضموري (ALS2 وALS5) وفي حالة عدم وجود طفرات في الجين SPG7، شاشة الجينوم على نطاق في الأسرة قدمت FSP-546 دليل على الربط على اثنين من علامات متتالية على الصبغي 2 بنتيجة متعددة اللد 3.8. تم الكشف عن ستة مواقع أخرى محتملة مع عشرات متعددة اللد> 1 على الكروموسومات 2، 7، 10، 11، 12 و 20، ولكن استبعدت عندما استخدمت 25 علامات إضافية (لا تظهر البيانات).
تحليل تسع الواسمات الوراثية الإضافية على الصبغي 2 إنشاء عشرات اللد البشرى كبيرة> 3 (الجدول 1) في علامات D2S2285 = 3.1) وD2S125 = 3.2). تم الحصول على القصوى ومتعددة كبيرة نتيجة اللد 3.8 في الفترة D2S2338-D2S2585 (الشكل 2)، وذلك بالاتفاق مع إعادة الإعمار النمط الفرداني يظهر أن جميع علامات في هذا سم الفاصل 5.1 كانت متماثل في المرضى المصابين (الشكل 1). وقد سمي هذا الموضع الجديد SPG30 وفقا لتسمية HUGO. هذا الفاصل الزمني يمتد المنطقة 4 ميجا بايت ويحتوي على 62 الجينات، واحدة منها، STK25، الذي يشفر بروتين كيناز تشارك في الاستجابة للإجهاد البيئي ونقل البروتين، لم يكن لديهم طفرات / الأشكال في الإكسونات الترميز، في المرضى.

تين. 2
تحليل الربط متعددة. يتم رسم عشرات اللد وفقا للخريطة الوراثية للكروموسوم 2Q. بالخط العريض يشار إلى علامات تستخدم للمسح الجينوم. سم = سنتي مورغان.


الجدول 1
عشرات اللد البشرى المحسوبة في الأسرة FSP-546 بين موضع المرض و9 الواسمات الوراثية على الصبغي 2
علامة اللد النتيجة عند θ


0.0 0.01 0.05 0.1 0.2 0.3 0.4 D2S338 ∞ -2.77 -0.88 -0.23 0.15 0.16 0.05 D2S345 -2.35 -0.84 -0.22 -0.01 0.09 0.07 0.01 D2S2338 -2.45 -0.96 -0.36 -0.17 -0.06 -0.01 0.01 D2S2285 3.11 3.05 2.79 2.47 1.80 1.12 0.44 D2S125 3.23 3.17 2.91 2.58 1.90 1.20 0.50 D2S395 1.35 1.33 1.22 1.08 0.79 0.49 0.20 D2S1378 2.80 2.74 2.50 2.20 1.57 0.94 0.33 D2S140 1.42 1.40 1.29 1.14 0.84 0.53 0.22 D2S2585 ∞ 0.85 1.32 1.33 1.05 0.64 0.23
  • اللد: وغاريتم الصعاب.

تم استبعاد الفترة الفاصلة بين علامات D2S2338 وD2S2585 في الأسر 10 ARHSP الأخرى عن طريق إعادة الإعمار النمط الفرداني و / أو تحليل الربط مع عدة نقاط عشرات اللد تحت عتبة -2 (لا تظهر البيانات).
المظاهر السريرية في الأسرة FSP-546

في الأسرة النووية FSP-546 (الشكل 1)، كان هناك تسعة أشقاء (ستة رجال وثلاث نساء) ولدت من الآباء والأمهات الذين كانوا الأقارب من الدرجة الأولى. تم فحص كل 11 أفراد وأخذ عينات لاستخراج الحمض النووي. أربعة من الأشقاء (ثلاثة رجال وامرأة واحدة) تأثرت سريريا وكان الفحص العصبي الطبيعي في ما تبقى من الأطفال والآباء على حد سواء. وكان متوسط ​​العمر عند بداية 17.5 ± 4 سنوات (12-21 سنة).
كانت الصورة العامة مشية تشنجية مع متغير المرتبطة القاصي الهزال، والاعتلال العصبي الحسي ورنح مخيخي (الجدول 2).

الجدول 2
الخصائص السريرية من 4 مرضى في الأسرة FSP-546
المظاهر السريرية المرضى


004 009 010 011 العمر عند بداية (سنة) 20 17 21 12 العمر عند الفحص (سنوات) 35 27 26 24 مدة المرض (سنوات) 15 10 5 12 اضطراب وظيفي لا استطيع الجري معتدل لا استطيع الجري لا استطيع الجري الشلل التشنجي في مشية معتدل معتدل معتدل شديدة في الاستراحه معتدل معتدل معتدل معتدل زيادة ردود الفعل في LL نعم فعلا نعم فعلا نعم فعلا نعم فعلا الباسطة منعكس أخمصي لا نعم فعلا نعم فعلا نعم فعلا ضعف دبوس وخز، والاهتزاز لا نعم فعلا نعم فعلا لا اختبار الأنف الإصبع لا أقل ما يقال المخيخ الجانب الأيسر للدماغ أقل ما يقال المخيخ اضطرابات العضلة العاصرة لا معتدل لا معتدل السعي العين رمشي لا نعم فعلا لا نعم فعلا الدماغ الاشعة المقطعية الثاني ضمور المخيخ منتشر خفيف الثاني الثاني
  • LL = الطرف السفلي. الثاني = لم تفعل.

وكان المريض مؤشر (FSP-546-004) رجل يبلغ من العمر 35 عاما الذي لاحظ لأول مرة الساقين شديدة في سن 20. وفي سن ال 25، وقال انه كان غير قادر على تشغيل واجهوا صعوبة نزول الدرج. أظهرت دراسة زيادة ردود الفعل في الأطراف السفلية (LL) والاستجابات المثنية أخمصي. وكانت ردود الفعل العادية في الأطراف العلوية. كان التشنج معتدل على المشي وعلى بقية مع ضعف معتدل في LL الداني. وكانت العضلات الهزال في ساقيه واضحة. كان شعور الاهتزاز والإحساس بوخز العادي، وكانت هناك اضطرابات العضلة العاصرة أو علامات للدماغ.
شقيقه (FSP-546-009) شكا في سن 17 من إحساس الوخز في الأطراف العلوية. عندما تم فحصه في سن 27 وقال انه لا يمكن أن يقف مع قدميه في المركز جنبا إلى جنب. كان هناك التشنج معتدل في أطرافه السفلى في المشي والراحة. وقال انه زيادة ردود الفعل في ركبتيه ولكن ليس في كاحليه وكانت ردود الفعل أخمصي الباسطة. كان هناك هدر القاصي خفيف في الأطراف السفلية وبعض الضعف البعيدة. أظهر اختبار أصابع الأنف الحماقات المخيخ. كما وصف المريض اضطرابات العضلة العاصرة خفيفة. / وقد انخفض مسة القاصي حساسية الوخز بالابر في الساقين، ولكن لوحظ شعور الاهتزاز في الكاحلين. ونظرة العين العادي باستثناء السعي رمشي. تم تسجيل انخفاض سعة المحرك الحسية ولكن الفسيولوجية خلال دراسات التوصيل العصبي (الجدول 3). أظهر الإبرة EMG نمط التوظيف انخفاض مع بعض الإمكانيات اطلاق بمعدل متزايد، وهو علامة على إزالة التعصيب. أظهر الدماغي الاشعة المقطعية أجريت في سن 29 ضمور المخيخ منتشر معتدل.

الجدول 3
دراسة التوصيل العصبي في FSP المريض 546-009

الصحيح اليسار



سعة السرعة (م / ث) سعة السرعة (م / ث) حسي العصب الكعبري (الحسية) 27 μV 59 5 μV 49 العصب الربلي 4 μV 53 2 μV 50 محرك العصب الشظوي المشترك 2.8 بالسيارات 52 3 بالسيارات 53 العصب الشظوي العميق 8 بالسيارات 47 7 بالسيارات 54

أختهم (FSP-546-010) وهي امرأة تبلغ من العمر 26 عاما، ولاحظت أولا عدم الثبات والساقين شديدة في سن ال 21. وكانت تعاني من الركبة مؤلمة وكان التشنج معتدل في الأطراف السفلية لها في الغالب في ساقها اليسرى، على المشي و في الاستراحه. وكشف الفحص السريري زيادة ردود الفعل في جميع أطرافه ومنعكس الباسطة أخمصي على كلا الجانبين. كان اختبار الإصبع الأنف المخيخ قليلا على الجانب الأيسر. وقد وصفت شعور الاهتزاز بشكل طبيعي في الكاحلين. وقد انخفضت تستهلكه ضجة كبيرة في كلا القدمين.
الأخ الأصغر سقط (FSP-546-11) عن طريق الخطأ في سن 11، وبعد ذلك مشية غير مستقرة والساقين أعراض شديدة تطويرها. في سن ال 19، وكان ضعف معتدل ولكن غير قادر على تشغيل. كان التشنج الشديد في المشي وزيادة توترية العضلات في بقية. وقال انه زيادة ردود الفعل في جميع أطرافه مع الكاحلين رمع والباسطة الثنائية ردود الفعل أخمص القدم. كان هناك هدر خفيف في الأطراف العلوية. وذكر أنه جرى الإلحاح البولي معتدل والساقين مؤلمة. كان السعي العين رمشي.

نقاش

رسمناها موضعا رواية ARHSP (SPG30) على الصبغي 2q37.3 في الأسرة الجزائرية الأقارب الذين يعيشون في شرق فرنسا. بعد استبعاد المرشح SPG وALS المكاني والمناطق الأخرى بنتيجة اللد> 1 في مسح الجينوم على نطاق، وظلت منطقة مرشح واحد على الصبغي 2. غرامة رسم الخرائط باستخدام تسع علامات إضافية وإعادة الإعمار النمط الفرداني ضاقت المنطقة مرشحة ل 4 ميغابايت الفترة. تم استبعاد الربط SPG30 أيضا في 10 عائلات ARHSP الأخرى الذين لا يحملون طفرات في الجين SPG7.
وهذا هو أول ARHSP مكان وجدت على كروموسوم 2 حيث شكلين من ADHSP، SPG4-الأكثر شيوعا وSPG13، كما تم يقع (الدر وآخرون، 1996.؛. هانسن وآخرون، 2002). ALS2 (Alsin) (يانغ وآخرون، 2001)، وشكل وراثي من الشلل الدماغي التشنجي (مكهيل وآخرون، 1999 خريطة) أيضا لكروموسوم 2، على الرغم من أن مناطق مختلفة وتختلف سريريا من SPG30 قبل حدوث الصلبية و علامات الكاذب (ALS2)، والتخلف العقلي والصرع والشلل الرباعي (الشلل الدماغي التشنجي). تحتوي المنطقة المكرر 62 الجينات، والعديد منها ترميز البروتينات يحتمل أن تشارك في HSP، بحسب وظائفها الفيزيولوجية (البروتينات متورطة في تهريب الجزيئية والأيض الميتوكوندريا). الطفرات نقطة في الجين STK25، الذي يشفر سيرين / ثريونين كيناز 25، استبعدت بواسطة التسلسل المباشر. فحص الجينات المرشحة أخرى جارية.
وعلى النقيض من جسمي HSP المهيمن حيث اثنين من الجينات، وترميز SPG3 atlastin-1 وSPG4 ترميز spastin، تشكل نسبة كبيرة من المرضى، ويبدو ARHSP أن يكون ناجما عن عدد وافر من الجينات، كما اقترح عدد من جديد ARHSP مواضع نشرت مؤخرا (هودجكينسون وآخرون، 2002.؛ ماير وآخرون، 2004.؛ Bouslam وآخرون، 2005... ويلكنسون وآخرون، 2005). SPG7، الشكل الأكثر شيوعا للARHSP ذكرت حتى الآن، الذي يشفر paraplegin، ويوضح جزء فقط من الحالات ARHSP (Elleuch وآخرون، 2006).
النمط الظاهري للأسرة SPG30 يتكون من بداية مبكرة وخزل سفلي تشنجي ببطء تدريجي يرتبط مع وجود علامات للدماغ طفيفة، مثل السعي رمشي العين، اصبع الأنف الحماقات، صعوبة في الوقوف جنبا إلى جنب وضمور المخيخ على مسح CT، عندما يقوم. بالإضافة إلى ذلك، أظهر الفحص الكهربية في مريض واحد وجود اعتلال الأعصاب المحيطية التي عثر عليها سريريا في مريض آخر. أخيرا، يبدو أن تطور المرض بطيئا كما كانت جميع المرضى قادرا على المشي بعد فترات المرض تصل إلى 15 عاما.
ويلاحظ التباين Phenotypical في العديد ARHSP والنمط الظاهري من SPG30 قد تكون أكبر مما لوحظ في هذه العائلة الجزائرية. أظهرت معظم الأسر اختبارها في هذه الدراسة النمط الظاهري ARHSP النقي، في حين وصفت معظم أشكال ARHSP المعروفة، بما في ذلك SPG30، كما معقدة مع عصبية إضافية أو المظاهر السريرية الأخرى (جدول 4). ولعل هذا يفسر لماذا لم نجد عائلات أخرى مرتبطة بموضع SPG30. على حد سواء، ومع ذلك، قد تكون مرتبطة أشكال نقية ومعقدة لنفس الموضع، كما هو مبين لSPG4 (Heinzlef وآخرون، 1998)، SPG7 (دي ميشيل وآخرون، 1998) وSPG27 (الرباعي وآخرون، 2006) .

الجدول 4
أشكال المتنحية معروفة من الشلل النصفي التشنجي، الكروموسومات التوطين، والمنتج الجينات والنمط الظاهري
رمز الجين موقع الكروموسومات منتج الجين النمط الظاهري العمر عند بداية (سنة) علامات المخيخ و / أو ضمور PNP علامات اضافية SPG5 (منير الهنتاتي وآخرون، 1994؛. يلكنسون وآخرون، 2003) 8Q-11q13 - نقي 1-40 لا - - SPG7 (Casari وآخرون، 1998؛. DeMichele وآخرون، 1998؛. يلكنسون وآخرون، 2004) 16q24.3 Paraplegin النقي، مجمع 11-42 نعم فعلا نعم فعلا قدم جوفاء، ضمور العصب البصري SPG11 (مارتينيز موريللو وآخرون، 1999) 15q13-Q15 - النقي، مجمع 1-50 لا - التخلف العقلي، وقدم جوفاء، CC رقيقة SPG14 (Vazza وآخرون، 2000) 3q27-Q28 - مجمع ~30 لا نعم فعلا قدم جوفاء، والتخلف العقلي، وعمه البصرية، ونقص الذاكرة SPG15 (هيوز وآخرون، 2001) 14q22-Q24
مجمع 13-23 نعم فعلا - تدهور الفكري، البقعة المصطبغة، CC وضمور الدماغ SPG20 (باتل وآخرون، 2002) 13q12.3 Spartin مجمع الطفولة المبكرة نعم فعلا - التخلف العقلي، وضيق في مكانة SPG21 (سيمبسون وآخرون، 2003) 15q21-Q22 Maspardin مجمع 20-40 نعم فعلا نعم فعلا متلازمة خارج هرمية، والخرف، CC رقيقة، الأبيض حول البطينات الدماغية مسألة hyperintensities، إعتام عدسة العين، خلل التوتر، رقص، ضمور العضلات اليد SPG23 (BLUMEN وآخرون، 2003) 1q24-Q32 - مجمع الطفولة المبكرة لا - تشوهات للجلد والشعر وتصبغ، خلل البنية؛ شوهة الوجه والهيكل العظمي، ورعاش الوضعي، الادراكي SPG24 (هودجكينسون وآخرون، 2002) 13q14 - نقي 1 لا - - SPG25 (Zortea وآخرون، 2002) 6q23-q24.1 - مجمع 30-46 لا نعم فعلا العديد من فتق القرص، وإعتام عدسة العين الثنائي، الزرق الخلقي SPG26 (ويلكنسون وآخرون، 2005) 12p11.1-12q14 - مجمع 22-42 لا نعم فعلا العاطفي، واللسان ورعاش، والقصور الفكري المعتدل SPG27 (ماير وآخرون، 2004؛. الرباعي وآخرون، 2006) 10-q22.1-q24.1 - النقي، مجمع 2-45 نعم فعلا نعم فعلا التخلف العقلي، وصغر الرأس، شذوذ البنية في الوجه، وتضيق الأجفان، خلل البنية؛ شوهة الهيكل العظمي SPG28 (Bouslam وآخرون، 2005) 14q21.3-q22.3 - نقي 15/06 لا - قدم جوفاء والجنف في 1 المريض SPG30 2q37.3 - مجمع 12-21 نعم فعلا نعم فعلا - الشلل الدماغي التشنجي (مكهيل وآخرون، 1999) 2p24-25 - مجمع الطفولة المبكرة - - التخلف العقلي، الصرع، صغر الرأس
  • CC = الجسم الثفني. PNP = اعتلال الأعصاب المحيطية.

على الرغم من أن خزل سفلي تشنجي ومن الواضح أن دلالة كبيرة في SPG30، يمكن فحص سطحي يغيب عن علامات العصبية المرتبطة بها (مثل علامات المخيخ) مما يؤدي إلى التشخيص الأولي من الذهب الخالص ويست معقدة HSP. هذه النتيجة مهمة في الممارسة السريرية منذ العديد من أشكال ARHSP الحاضر مع وجود علامات إضافية للدماغ (14/06 ARHSP مواضع، الجدول 4) والتي يمكن التغاضي عند فحص المرضى الذين يعانون من التشنج بارز. مشاركة المخيخ المعتدل الذي عثر عليه في هذا الشكل الجديد من ARHSP مماثلة لتلك التي لوحظت في المرضى الذين يعانون من SPG7 (paraplegin) الطفرات، التي كانت أيضا كان يعتقد في البداية أن يكون ARHSP نقية (دي ميشيل وآخرون، 1998). وقد أظهرت الدراسات التي أجريت مؤخرا، مع ذلك، أن إشارات للدماغ خفيفة و / أو ضمور المخيخ على تصوير الدماغ ثابتة تقريبا في SPG7 (Elleuch وآخرون، 2006). ترتبط العديد من الأشكال الأخرى من ARHSP أيضا مع الاعتلال العصبي (جدول 4) وارتباطه رنح مخيخي ليس محددة لSPG30 ولكن يمكن أيضا أن تكون موجودة في SPG7، SPG21 وSPG27.
وفي الختام فإننا قمنا تعيين موضعا رواية (SPG30) لكروموسوم 2q37.3 هي المسؤولة عن شكل جديد راثي متنحي من التعقيد HSP. هذه هي الخطوة الأولى نحو تحديد جين جديد حاسم لفهم الفيزيولوجيا المرضية الكامنة وراء HSP.

مصادر إلكترونية

مركز Mashfield لعلم الوراثة الطبية: http://www.marshfieldclinic.org/genetics
المركز الوطني للتحقيقات البيولوجية (NCBI): http://www.ncbi.nlm.nih.gov
متصفح الجينوم Ensembl: http://www.ensembl.org
منظمة الجينوم البشري (HUGO): http://www.gene.ucl.ac.uk/hugo/

 

__________________
استشارى الادوية الطبيعيه وباحث وخبير فى علاجات التوحد
رد مع اقتباس
  #14  
قديم 11-22-2015, 10:57 PM
رافت ابراهيم رافت ابراهيم غير متواجد حالياً
عضو ذهبي
 
تاريخ التسجيل: Dec 2011
المشاركات: 520
افتراضي تفاعل اثنين وراثية المنتجات الشلل النصفي التشنجي الجينات، spastin وatlastin، يشير إلى وجود مسار مشترك لصيانة محور عصبي

 

http://www.pnas.org/content/103/28/10666.full

ملخص

الشلل النصفي التشنجي وراثي (HSP) هو اضطراب الاعصاب التي تتميز تنكس محور عصبي الوراء الذي يؤثر على الخلايا العصبية في المقام الأول في العمود الفقري طويلة. هذا المرض هو غير متجانس سريريا، وهناك> 20 المواضع الجينية التي تم تحديدها. هنا، وتبين لنا التفاعل الجسدي بين spastin وatlastin، وهما جسمية مهيمنة منتجات الجين HSP. Spastin يشفر أنيبيب (MT) -severing AAA أتباز (أتباز المرتبطة بالأنشطة المختلفة)، وatlastin يشفر بروتين الغشاء لا يتجزأ GTPase المترجمة جولجي. Atlastin لا تنظم النشاط الأنزيمي من spastin. حددنا أيضا طفرة السريرية في atlastin خارج المجال GTPase الذي يمنع التفاعل مع spastin في الخلايا. ولذلك، فإننا نفترض أن عدم التفاعل المناسب بين هذين HSP منتجات الجينات قد تكون ذات صلة pathogenetically. وتشير هذه البيانات إلى أن ما لا يقل عن مجموعة فرعية من الجينات HSP قد تحدد مسار بيولوجي الخلوية التي أمر مهم في صيانة محور عصبي.
وراثي الشلل النصفي التشنجي (HSP) هو اضطراب وراثيا وغير متجانسة سريريا أن يتميز سريريا من قبل مشية تشنجية، حسي اهتزازي معتدل، والإلحاح البولي ومرضي من قبل axonopathy رجعية أن ينطوي في المقام الأول على الخلايا العصبية طويلة من الجهاز القشري والحزمة الناحلة (1 ). هناك> 20 جينات مرتبطة HSP. وقد وصفت لم التفاعل الجزيئي بين أي من البروتينات المشفرة بواسطة هذه الجينات.
بصفة عامة، وقد أدت وظائف ثبت أو الاستدلال من الجينات HSP إلى عدة فرضيات واسعة حول المرضية الجزيئي للHSP. وقد اقترح HSP أن يكون اضطراب الميتوكوندريا، استنادا إلى حقيقة أن اثنين من الجينات HSP، paraplegin (2) وmtHSP 60 (3)، هي بروتينات الميتوكوندريا مع الأدوار في مراقبة الجودة من البروتين وقابلة للطي. الطفرات في KIF5a، وهو كينيسين التقليدية التي يتم التعبير بشكل كبير في الخلايا العصبية، يسبب HSP (4)، مما يدل على أن نقل محور عصبي ضعف قد تكمن وراء بعض أشكال المرض. الطفرات في spastin (SPG-4)، وهو AAA أتباز (أتباز المرتبطة بالأنشطة المختلفة)، يسبب 40٪ من حالات جسمية مهيمنة من HSP (5). نحن وغيرنا قد أظهرت أن spastin هو أنيبيب (MT) انزيم -severing وأن الطفرات المرض يضعف هذا النشاط (6، 7).
وترتبط العديد من الجينات HSP مع مختلف العضيات غشائي ولقد استنتج الأدوار في الاتجار حويصلي. Spastin وspartin (SPG-20) (8)، جين آخر HSP، سواء تحتوي على معهد ماساتشوستس للتكنولوجيا (أنيبيب التفاعل والنقل) المجال (9)، والتي كثيرا ما وجدت في البروتينات المرتبطة الاندوسوم، بما في ذلك Vps4، وهو AAA أتباز أن يفكك ESCRT (endosomal الفرز المعقدة اللازمة لنقل) مجمعات البروتين كجزء من مسار الجسم عديد الحويصلات (10). MIT Spastin ويربط CHMP1B (11)، واحد من عائلة من البروتينات المتورطين في مسار الجسم عديد الحويصلات. الطفرات في atlastin (12)، والغشاء لا يتجزأ من البروتين GTPase الذي المترجمة في المقام الأول إلى جهاز جولجي (13)، كما يسبب HSP. الطفرات في alsin، التي لديها راب 5 وراك جوانين مجالات تبادل النوكليوتيدات، تشير إلى أن وجود خلل في الاتجار داخل الخلايا قد يسبب HSP (14، 15).
سريريا، يمكن HSP يكون المتغير فيما يتعلق عمر البدء، انتفاذ، التعبيرية من النمط الظاهري، ومجموعة من التشوهات العصبية الموجودة في المرضى. ونظرا لعدم التجانس وفرضيات لا تعد ولا تحصى من الأساس الجزيئي لفقدان محور عصبي في HSP، ينشأ السؤال المركزي حول ما درجة غير HSP مرض واحد. وبعبارة أخرى، القيام بأي أو بعض هذه الجينات مرض تعمل معا في المسار الخلوي واحد وظيفتها مهم في صيانة محور عصبي؟ التفاعل وصفنا بين spastin وatlastin تشير إلى أن مجموعة فرعية من منتجات الجين HSP قد تعمل بهذه الطريقة.
النتائج

لتحديد البروتينات التفاعل spastin، أجرينا الخميرة شاشة يومين الهجينة التي تستخدم بالطول spastin كطعم. فحص حقق 12 استنساخ المستقلة، واحدة منها المشفرة جزء من atlastin-1 (الشكل 1 A). مثل spastin، atlastin هو الصفة السائدة HSP الجين (12). Atlastin هو لا يتجزأ GTPase بروتين الغشاء جولجي المترجمة (13). كان استنساخ استردادها في إطار ويفتقر المجال GTPase لكن ترميز اثنين من شرائح الغشاء والذيل حشوية (C-الذيل) من atlastin. حذف المجال-C الذيل من هذا استنساخ (496 إيقاف) في atlastin-1 البشري إلغاء التفاعل في الخميرة فحص اثنين من الهجين (الشكل 1 A).

تين. 1.
Spastin-atlastin التفاعل. (A) A الخميرة الشاشة هجين اثنين حددت atlastin باعتباره interactor لspastin. وقد استخدم كامل طول spastin الإنسان كطعم وتفاعلوا مع ترميز استنساخ الأحماض الأمينية 408-558 من atlastin-1 البشري. وقد استخدمت هذه استنساخ ومتحولة الحذف تفتقر إلى C-ذيل atlastin (ΔCtail) لretransform الخميرة في فحص اثنين من الهجين. استنساخ الأصلي، ولكن ليس استنساخ ΔCtail، تفاعلت مع spastin في هذا الاختبار. (B) Coimmunoprecipitation من spastin وatlastin. خلايا هيلا وعابر. لمدة 24 ساعة مع 2HA-spastin وإما atlastin-صاحب-6X (المحللة 1) أو صاحب-6X الموسومة β-غال (المحللة 2) كوسيلة لمراقبة سلبية. تعرض لست] الخلية إلى مناعي مع الأجسام المضادة له-6X تليها مكافحة HA (يسار) أو مكافحة صاحب-6X (يمين) النشاف الغربي. وأعرب كلا لست] المبالغ المعادلة من HA-spastin (SM) وspastin coimmunoprecipitated مع atlastin ولكن ليس بيتا غال. في 50- وشرائح 20 كيلو دالتون هي سلاسل الثقيلة والخفيفة IG. (C) Coomassie هلام الزرقاء الملطخة تبين أن spastin بربط atlastin C-الذيل. تم المشقوق ضريبة السلع والخدمات من GST-spastin بدقة البروتيني (PP)، وخليط التفاعل الخام (حارة 3) تحتوي على 10 ميكروغرام من spastin تم تطبيقها على حبات الجلوتاثيون سيفاروز تحتوي على 10 ميكروغرام من GST-atlastin C-الذيل أو ضريبة السلع والخدمات وحدها ( الممرات 4-6) في إجمالي حجم 200 ميكرولتر. الممرات 1 و 2 عرض عينات من الخرز التي تحتوي على GST atlastin الوحيد C-الذيل أو ضريبة السلع والخدمات. جميع spastin أضاف لكن أيا من GST المشقوق أو PP منضمة إلى atlastin C-الذيل، وATP لم يكن مطلوبا للربط (قارن الممرات 4 و 5). وعلى النقيض من GST-spastin، لا يحتوي على البروتين GST atlastin-C الذيل موقع انشقاق PP.

المقبل، ونحن cotransfected خلايا هيلا مع البلازميدات ترميز spastin 2HA الموسومة وإما atlastin-6xHis أو β-غال-6xHis (الشكل 1 B). تعرض لست] توضيح لمناعي مع الأجسام المضادة لمكافحة 6xHis. جرى التحقيق Immunoprecipitates لspastin من قبل مكافحة هيماغلوتينين (HA) النشاف الغربي. Spastin coprecipitated مع atlastin ولكن ليس مع β-غال، على الرغم من أن أعرب عن البروتين السيطرة على مستوى أعلى من atlastin (الشكل 1 B). وأكد الغربية النشاف مع الأجسام المضادة لمكافحة HA أن كلا لست] أعربت المبالغ المعادلة من spastin. الأضداد HA الكشف عن شريطين المتعلقة spastin. على الرغم من أننا لا نعرف لماذا، ونحن نتصور أن الشريط العلوي قد تمثل صيغة معدلة posttranslationally من spastin. على الرغم من أنه يبدو كما لو سوى أقل الفرقة الزميلة مع atlastin، لا يمكننا استبعاد احتمال أن الشريط العلوي تربط لكن هذا لم نتمكن من الكشف عن ذلك بسبب وفرة أقل من هذا النموذج.
لأن الخميرة تحليل هجين اثنين أشارت إلى أن C-ذيل atlastin ملزم spastin، أنتجنا وتنقيته المؤتلف GST-atlastin C-الذيل. تم المشقوق شاردة GST الخروج من spastin المؤتلف مع البروتيني للموقع المحدد. تمت إضافة خليط التفاعل spastin / GST / البروتيني إلى يجمد حبة GST atlastin C-الذيل أو ضريبة السلع والخدمات. لا يحتوي على C-ذيل البروتين الانصهار GST atlastin موقع الدقة البروتيني، وبالتالي لم المشقوق من قبل البروتيني. Spastin متجهة إلى GST atlastin C-ذيل، ولكن ليس إلى GST، بطريقة ATP مستقلة، مما يدل على التفاعل المباشر (الشكل 1 C). أجرينا أيضا هذه التجربة مع كامل طول GST-spastin ثبتوا على حبات واستحوذ على كامل طول المالتوز المؤتلف البروتين atlastin ملزمة (في المخازن التي تحتوي على المنظفات) (انظر الشكل رقم 6، التي تصدر عن دعم المعلومات على شبكة الإنترنت PNAS موقع).
إضافة فائض المولي 10 أضعاف من GST-atlastin C-الذيل ولكن ليس GST تسبب زيادة طفيفة جدا في النشاط أتباز spastin في المختبر (الشكل 7، التي تصدر عن دعم المعلومات على الموقع الشبكي PNAS). بعد ذلك، طلبنا ما إذا كان هذا زيادة طفيفة في أتباز نتائج النشاط في تعزيز قطيعة MT. تحقيقا لهذه الغاية، ونحن المحتضنة ضريبة السلع والخدمات spastin مع، النظام التجاري المتعدد الأطراف استقرت التاكسول المسمى رودامين في غياب أو وجود فائض المولي 10 أضعاف من GST-atlastin C-الذيل. في نقاط زمنية مختلفة، وإزالة aliquots من كل رد فعل، ولم تتوقف انقطاع بإضافة غلوتارالدهيد. وقد تم قياس طول MT من الميكروسكوب، وحسبت متوسط ​​أطوال. الشكل. 2 A يدل على أن متوسط ​​طول النظام التجاري المتعدد الأطراف بمرور الوقت. نحن لم يكشف عن أي تغييرات التي يسببها atlastin في حد أو المعدل الظاهر من MT تقصير في هذا الاختبار. على الرغم من أننا لم يكشف أي تأثير atlastin، وفحص المرجح لديها هامش كبير من الخطأ، ونحن لا نستطيع استبعاد دور للatlastin في تحوير النشاط spastin. بالاتفاق مع المختبر في البيانات، لم cooverexpression من atlastin-FLAG جنبا إلى جنب مع الأصفر بروتين فلوري (YFP) -spastin في كوس-7 الخلايا لا يمنع بوساطة spastin انقطاع (الشكل 2 B).

تين. 2.
Atlastin C-الذيل لا تمنع بوساطة spastin MT انقطاع. استخدمت (A) استقرت تاكسول، النظام التجاري المتعدد الأطراف المسمى رودامين وspastin، قطع فحوصات بدون أو مع المؤتلف atlastin C-الذيل كما هو موضح في المواد وطرق. في النقاط الزمنية المشار إليها، توقفت ردود الفعل من قبل التثبيت في غلوتارالدهيد. تم تصويرها النظام التجاري المتعدد الأطراف، وحسبت متوسط ​​أطوال كما هو موضح في المواد وطرق. ويبين الرسم البياني شريط أطوال متوسط ​​± الخطأ المعياري. تظهر photomicrographs تمثيلية مدى MT انقطاع. لم يكن هناك فرق ملحوظ بين ردود الفعل المحتضنة مع أو بدون C-الذيل. يظهر Coomassie هلام الزرقاء الملطخة المبالغ النسبية لكل بروتين (تويولين، 0.1 ملغ / مل؛ spastin، 0.02 ملغ / مل). تم استخدام C-الذيل في 10 أضعاف الرحى الزائدة مقارنة مع spastin. تم cotransfected (B) كوس-7 الخلايا مع YFP-spastin وatlastin-FLAG. بعد 24 ساعة، تم إصلاح الخلايا وملطخة مكافحة FLAG و أضداد تويولين. Spastin (الخضراء) وatlastin (الأحمر) colocalize. الخلايا المصابة بالعدوى بالنقل تظهر انخفض MT (الأزرق) محتوى مقارنة مع الخلايا المجاورة. (مقياس شريط 15 ميكرون).

ومع ذلك، فإننا لم تلاحظ أن في الخلايا cotransfected، ونمط atlastin-FLAG تلطيخ يبدو غيرت (الشكل 2 B) مقارنة مع الخلايا المصابة بالعدوى بالنقل فقط مع atlastin-FLAG (الشكل 8، التي تصدر عن دعم المعلومات على الموقع الشبكي PNAS ). في حين تم العثور على معظم atlastin الذاتية في جولجي (13)، وoverexpressed atlastin-FLAG colocalizes معظمها مع علامة جولجي (الشكل 8) في الخلايا cotransfected، وcodistributed atlastin-FLAG في نقاط ومع spastin. كما هو الحال مع اضطراب MT الناجمة عن العديد من العلاجات، نتائج فقدان MT-الناجم عن spastin في تشتت جولجي (لا تظهر البيانات). على الرغم من spastin overexpressed وatlastin وcolocalized في هذه التجربة (الشكل 2 B)، ويظهر لا البروتين نمط تلطيخ هذا هو الحال في أي الذاتية البروتين (انظر الشكل 4 A).
ومع ذلك، اقترحت هذه التجربة أن التجارب cotransfection قد يكون وسيلة مريحة لتحديد مجالات spastin وatlastin اللازمة لcoassociation في الخلايا. للالتفاف على حقيقة أن WT spastin يدمر النظام التجاري المتعدد الأطراف، وهذا بدوره قد تغير توطين التحت خلوية من البروتينات، وكنا E442Q spastin متحولة، الذي يربط النظام التجاري المتعدد الأطراف ولكن لا يمكن أن يطلق أو قطع (6)، وبالتالي يزين النظام التجاري المتعدد الأطراف في الخلايا المصابة بالعدوى بالنقل. والمثير للدهشة، أدى cotransfection مع spastin E442Q وatlastin-FLAG في atlastin توزع جنبا إلى جنب مع spastin على النظام التجاري المتعدد الأطراف (الشكل 3). في نفس الخلايا، مورفولوجيا جولجي وفقا لتقييم GM130 تلطيخ يبدو طبيعي نسبيا (الشكل 9، التي تصدر عن دعم المعلومات على الموقع الشبكي PNAS). لأن atlastin هو بروتين الغشاء لا يتجزأ، ونحن نتصور أن الحويصلات تحمل تصنيعه حديثا atlastin-FLAG من الشبكة الإندوبلازمية إلى جولجي أو بعد جولجي-الحويصلات تحمل atlastin يجب أن يكون قد جند لspastin متجهة الى MT. من هذا الاختبار، فإننا نستنتج فقط أن اثنين من البروتينات في الخلايا تتفاعل بطريقة بحيث واحد يؤثر على توطين البعض. في المرضى المصابين حيث لا هى overexpressed spastin متحولة، وقد لوحظ عدم وجود علاقة مستقرة من spastin متحولة مع النظام التجاري المتعدد الأطراف (16).

تين. 3.
التفاعل Spastin atlastin في الخلايا. في كوس-7 خلايا cotransfected مع YFP-E442Q spastin وatlastin-FLAG، atlastin هو "تجنيد" إلى النظام التجاري المتعدد الأطراف جنبا إلى جنب مع متحولة spastin، مشيرا إلى أن اثنين من البروتينات تتفاعل في الخلايا (A - C). حذف المنطقة N-الطرفية (بقايا 1-132) من spastin (G - I)، ولكن ليس MIT (بقايا 116-194) (J - L) أو اكسون 4 (بقايا 195-227) (M - O) المجالات، منع تجنيد atlastin. حذف C-الذيل من atlastin منع تجنيد (D - F).

وعدم تجنيد Atlastin تفتقر إلى C-الذيل إلى spastin E442Q (الشكل 3)، بما يتفق مع ربط البيانات في المختبر أظهرت أن spastin بربط atlastin C-الذيل. لتحديد مجال spastin هي المسؤولة عن التفاعل atlastin، قدمنا ​​سلسلة من عمليات الحذف مجال واحد في spastin. بشكل عام، spastin هو جزيء ثنائي مع C-محطة مجال AAA أتباز (الأحماض الأمينية 344-616). المنطقة-N من محطة spastin (الأحماض الأمينية 1-343) يحتوي على أربعة نطاقات فرعية متميزة. 115 الأحماض الأمينية الأولى من spastin تحتوي على منطقة البرولين الغنية ومجال مسعور. وتشمل الأحماض الأمينية 116-194 المجال MIT (9). اكسون 4 (الأحماض الأمينية 195-227) وتقسم بدلا من ذلك، والقليل هو المعروف عن هذا المجال (17). المجال-N محطة، ولكن لا مجال MIT ولا اكسون 4، مطلوب للتجنيد atlastin (الشكل 3). معا، وهذه النتائج تشير إلى أن المجال N محطة من spastin بربط C-ذيل atlastin. اثنين من الأشكال (S44L وP45Q)، والتي قد تكون بمثابة المعدلات الوراثية (18)، وطفرة الأمراض المرتبطة (dupA102، S103) (19 تقع) في هذه المنطقة-N من محطة spastin. أيا من هذه التغييرات في spastin منع تجنيد atlastin في مقايسة cotransfection (الجدول رقم 1، التي تصدر عن دعم المعلومات على الموقع الشبكي PNAS). باستخدام فحوصات ترنسفكأيشن والعمل مع النظام التجاري المتعدد الأطراف النقاء في videomicroscopic قطع فحص (6)، وجدنا أن Δ1-227 spastin (تفتقر المنطقة N-المحطة، المجال MIT، واكسون 4) يمكن ما زالت تفصل النظام التجاري المتعدد الأطراف ولها نشاط مماثل أتباز لذلك من البروتين كامل طول (لا تظهر البيانات وبيانات غير منشورة).
درسنا عدة طفرات في كل spastin وatlastin باستخدام هذا الاختبار (انظر الجدولين 1 و 2، والتي يتم نشرها عن دعم المعلومات على الموقع الشبكي PNAS). قمنا بتحليل اثنين من الطفرات السريرية في atlastin C-الذيل وجدت أن R495W (20)، ولكن ليس ins1688A، تفاعلت مع spastin (الشكل 10، التي تصدر عن دعم المعلومات على الموقع الشبكي PNAS).
رفعنا الأجسام المضادة لكلا spastin وatlastin وفحص ما إذا كان spastin الذاتية وatlastin colocalize في خلايا كوس. وتظهر البقع غرب لست] الخلية باستخدام الأجسام المضادة تنقية تقارب (الشكل 11، التي تصدر عن دعم المعلومات على الموقع الشبكي PNAS). أظهر الأجسام المضادة atlastin نمط تلطيخ محيط بالنواة (الشكل 4) مماثلة لتلك التي نشرتها تشو وآخرون. (13). كثافة تلطيخ تنوعت بين الخلايا. وكانت كثافة تلطيخ spastin الذاتية يتناسب مع كمية من atlastin أعرب (الشكل 4 A). أيضا، كان هناك colocalization الجزئي لاثنين من البروتينات الذاتية.

تين. 4.
Colocalization من spastin الذاتية وatlastin. (A) كوس الخلايا وملطخة الأجسام المضادة لatlastin وspastin. تم الكشف عن إشارات باستخدام قبرصي-5-مترافق أو اليكسا فلور 488 الضد الثانوية. تم الكشف عن إشارة Spastin باستخدام فلور اليكسا 488. لاحظ colocalization الجزئي لاثنين من البروتينات. وكانت Atlastin كثافة تلطيخ المتغيرة، وإشارة spastin أعلى في الخلايا معربا عن المزيد من atlastin. (B) Spastin رني لا يغير بشكل ملحوظ atlastin تلطيخ. تم قمع التعبير Spastin (يسار) جزئيا ترنسفكأيشن من سيرنا spastin محددة ولكنها ليست سيرنا المخفوق. أظهر ترنسفكأيشن مع سيرنا المسمى رودامين أن> 90٪ من الخلايا و transfected (لا تظهر البيانات). كانت ملطخة coverslips مكررة أعدت من نفس transfections لatlastin الذاتية (يمين)، والتي ظهرت دون تغيير. (C) آثار atlastin رني على spastin. الخلايا كانت ثابتة 48 ساعة بعد ترنسفكأيشن، وتكرار coverslips كانت ملطخة إما spastin أو atlastin. في هذه التجربة، لوحظ تلوين الخلفية من نوى في بعض الأحيان. الخلايا المصابة بالعدوى بالنقل، التي حددها GFP التعبير (إدراجات) بالرمز النصال. كانت ملطخة النوى مع دابي (الأزرق). مقارنة مع الخلايا nontransfected، يتم منعها atlastin تلطيخ جزئيا في atlastin رني ولكن ليس في خلايا رني السيطرة. مقارنة مع الخلايا السيطرة transfected، أظهرت نسبة مئوية صغيرة من الخلايا تعرض لatlastin رني تركيز محيط بالنواة من spastin (29٪ مقابل 45٪، ن = 135 الخلايا من كل ترنسفكأيشن). التحليل الكمي لطخة غربية من عدد متساو من الخلايا المصابة بالعدوى بالنقل الحصول عليها عن طريق التدفق الخلوي يوضح أن atlastin قمع كان 60٪ وخفضت أن مستويات spastin أيضا درجة مماثلة. وتم تطبيع إشارات إلى كثافة أكتين. (أشرطة النطاق، 15 ميكرومتر).

سألنا عما إذا تدخل الحمض النووي الريبي (رني) إسكات بوساطة أي من spastin أو atlastin تتأثر البروتين الأخرى. قمع Spastin، باستخدام الحمض النووي الريبي التدخل باختصار (سيرنا) التي تحققت، أدى إلى انخفاض ولكن لم تلغ تلطيخ spastin (الشكل 4 B) ولكن لم يغير بشكل ملحوظ إما نمط atlastin تلطيخ أو شدة. في تحليل لطخة غربية، لم قمع spastin بنسبة 50٪ بحلول رني لا يؤدي إلى مستويات atlastin تغيير (لا تظهر البيانات). لقمع atlastin، ونحن transfected الخلايا مع البلازميد التي تحتوي على الحمض النووي الريبي دبوس الشعر القصير (shRNA) معين لatlastin. الخلايا المصابة بالعدوى بالنقل coexpress GFP جنبا إلى جنب مع shRNA. النشاف الغربي من الخلايا المصابة بالعدوى بالنقل الحصول عليها عن طريق التدفق الخلوي (الشكل 4 أظهر C) 60٪ قمع atlastin. ومن المثير للاهتمام، كما أدى atlastin رني في انخفاض مماثل في مستويات spastin. أدى Atlastin رني في انخفاض بنسب مختلفة atlastin تلطيخ مقارنة مع الخلايا السيطرة (الشكل 4 C). وفيما يتعلق تلطيخ spastin، أظهرت 45٪ من الخلايا السيطرة transfected منطقة محيط بالنواة مع المركز تلطيخ spastin (انظر الشكل 4 C). في المقابل، أظهرت 29٪ فقط من الخلايا atlastin رني transfected هذه الميزة. انخفاض في spastin تلطيخ محيط بالنواة يمكن أن تنجم عن أي انخفاض مستويات spastin أو عدم القدرة على التركيز spastin إلى المناطق التي تحتوي على atlastin.
كنا نتساءل عما إذا atlastin overexpression من شأنه أن يؤدي في التعيين وربما زيادة مستوى ثابت للدولة من spastin الذاتية. أيضا، لاختبار ما إذا كان atlastin C-الذيل هو ضروري وكاف لهذه الظواهر، أنشأنا اثنين من بنيات إضافية. بين أفادت والطفرات المسببة للأمراض في atlastin واحد هو أن يحذف أكثر من C-الذيل (21). هذه الطفرة، والإدراج من الأدنين في موقف 1688، تغير القراءة إطار 10 أأ إلى C-الذيل، ويضيف تسلسل غير الأصليين، ويدخل وقف كودون سابقة لأوانها. مثل بناء ΔC الذيل المستخدمة في الشكل. منعت هذه الطفرة التفاعل spastin في مقايسة cotransfection (الشكل 10). نحن أيضا خلق بناء (atlastin C-الذيل جولجي) مع atlastin C-الذيل FLAG شاردة تنصهر شاردة جولجي في توطين (بقايا galactosyl ترانسفيراز الأحماض الأمينية الترميز التي هي المسؤولة عن جولجي التعريب).
نحن transfected الخلايا مع البلازميدات ترميز WT-atlastin-FLAG، ins1688A-atlastin-FLAG، أو atlastin C-الذيل جولجي. تم إصلاح الخلايا وملطخة المزدوج لFLAG وspastin الذاتية (الشكل 5). في الخلايا overexpressing atlastin تفتقر إلى C-الذيل (atlastin-ins1688A)، لم colocalized spastin الذاتية مع atlastin overexpressed. في هذه الخلايا، وتلطيخ spastin أيضا أقل كثافة (الصورة المعروضة في الشكل 5 تم الحصول E باستخدام قتا أطول التعرض لجعل تلطيخ spastin مرئية). أيضا، وتلطيخ spastin في كل من الخلية transfected والخلايا nontransfected تظهر مشابهة في كثافة والتوزيع. في المقابل، في خلايا overexpressing WT atlastin-FLAG أو atlastin C-الذيل جولجي، وcolocalized spastin الذاتية مع atlastin overexpressed. وبمقارنة خلايا ثلاثة صورت في الشكل. 5 G و H، وكمية من تلطيخ spastin الذاتية يتناسب مع كمية atlastin-C الذيل جولجي التعبير عنها. وتشير هذه النتائج إلى أن C-ذيل atlastin ضروري وكاف لتجنيد spastin. جنبا إلى جنب مع البيانات في الشكل. 4 فإنها تشير أيضا إلى أن مستويات atlastin وspastin ترتبط. قمنا بقياس مضان atlastin-FLAG ومضان من spastin الذاتية في الخلايا المصابة بالعدوى بالنقل وnontransfected تم اختيارها عشوائيا. مؤامرة من شدة atlastin-FLAG مقابل كثافة spastin تبين أن هناك علاقة جيدة بين مستويات atlastin وspastin على أساس خلية تلو خلية (الشكل 5).

تين. 5.
وatlastin C-الذيل اللازم والكافي لتجنيد spastin الذاتية للجولجي. كوس و transfected الخلايا مع WT atlastin-FLAG (A - C)، ins1688A-atlastin-FLAG (D - F)، أو atlastin-C الذيل جولجي (G - I) لمدة 48 ساعة. كانت ملطخة الخلايا باستخدام الأجسام المضادة FLAG (قبرصي-5 الضد الثانوية في A، D، G و، كما هو موضح باللون الأحمر) والملون لspastin الذاتية (فلور اليكسا 488 كشف في B، E، H و، كما هو موضح باللون الأخضر). لاحظ colocalization الجزئي للspastin مع-C الذيل جولجي بالوزن وatlastin ولكن ليس مع ins1688A-atlastin. وتزداد كثافة Spastin في الخلايا معربا عن المزيد من atlastin-C الذيل جولجي (قارن الخلايا في G و H). تم الحصول على صورة في E مع زيادة مدة التعرض لتصور أفضل لتلطيخ spastin. لاحظ أن مستويات spastin هي نفسها في الخلايا المصابة بالعدوى بالنقل وnontransfected ولا المترجمة التي spastin مع atlastin. تظهر لطخة غربية أن الخلايا المصابة بالعدوى بالنقل مع البلازميدات ترميز atlastin-YFP أو atlastin C-الذيل جولجي، ولكن ليس YFP، وتظهر زيادة مستويات spastin الذاتية (كما هو موضح باللون الأخضر). الأرقام أعلاه كل حارة تظهر الزيادة النسبية في مستويات spastin [مقارنة مع الخلايا YFP transfected وتطبيع للالأكتين التعبير (أحمر)]. ويبين الرسم البياني spastin كثافة مضان بوصفها وظيفة من كثافة مضان atlastin-FLAG في الخلايا المحددة بشكل عشوائي. لديها خلايا لا overexpressing atlastin-FLAG بمتوسط ​​كثافة spastin من 95 وحدة تعسفية.

المقبل، ونحن transfected الخلايا مع YFP، atlastin-YFP، أو atlastin-C الذيل جولجي. بعد 24 ساعة، تم فحص مستويات spastin عن طريق ويسترن الكمية النشاف (الشكل 5). فحص الخلايا YFP وYFP معربا عن تحلل قبل كشف الكفاءات ترنسفكأيشن متساوية من ≈70٪. overexpression من atlastin-YFP، ولكن ليس YFP وحده، أدت إلى زيادة ≈3 أضعاف في إشارة spastin، في حين أدى overexpression من atlastin C-الذيل جولجي في زيادة 7.8 أضعاف في spastin.

نقاش

أظهرنا أن المجال N-محطة من spastin يربط مباشرة إلى المجال-C محطة حشوية من atlastin. هذا التفاعل بين اثنين من المنتجات HSP جين المرض تشير إلى أن بعض> 20 الجينات HSP قد تحدد مسار بيولوجي الخلوية التي أمر مهم في صيانة محور عصبي. أظهرنا أيضا متحولة HSP المرتبطة ins1688A-atlastin لا تتفاعل مع spastin، مما يوحي بأن HSP يمكن أن تنجم عن عدم وجود تفاعل طبيعي بين spastin وatlastin.
لا حذف ولا الطفرات مغلطة في-N محطة GTPase مجال atlastin لمنع تجنيد (الجدولين 1 و 2). وبالتالي، فإن دور النشاط GTPase، إن وجدت، في تنظيم تفاعل atlastin spastin غير واضح.
في حين أن هذه الورقة تحت المراجعة، ساندرسون وآخرون. (22) أن spastin وatlastin التفاعل في الخميرة اثنين الهجين الفحص. وعلى النقيض من النتائج التي توصلنا إليها، فإنها ذكرت أن الجزء N-محطة من atlastin يربط spastin. واستند هذا الاستنتاج على تجربة حيث حضنت لست] من الخلايا المصابة بالعدوى بالنقل مع spastin مع GST-1-447 atlastin أو مع GST وحدها. لأن atlastin الذاتية كان حاضرا أيضا في هذه الخلايا، ولأن atlastin قادر على homooligomerization (13)، فمن الممكن أن التفاعل وحظ وغير المباشر. باستخدام الخميرة فحص اثنين من الهجين (الشكل 1)، وفحص التوظيف حيث الذيل C ولكن ليس مطلوبا أول 447 الأحماض الأمينية atlastin للتجنيد (التين. 3 و5 والجدولين 1 و 2)، والمؤتلف المنقى البروتينات (الشكل 2)، ودراسة spastin الذاتية (الشكل 5)، وتبين لنا أن atlastin C-ذيل يربط مباشرة إلى spastin وغير ضروري وكاف للتفاعل spastin.
لأن atlastin بربط منطقة spastin هذا هو الاستغناء عن MT انقطاع (لا تظهر البيانات)، ولأن وجدنا أن atlastin المؤتلف C-ذيل لم يغير بوساطة spastin MT انقطاع في المختبر (الشكل 2)، ونحن نعتقد أنه يجوز atlastin العمل في توطين spastin. الأدلة الحالية تشير إلى أن atlastin وجدت في جولجي ويترافق مع حويصلات في المحاور ومخاريط النمو في الخلايا العصبية (23)، أثار احتمال أن تكون بعض atlastin من جولجي يحصل تعبئتها في حويصلات جولجي مشتقة. Atlastin يمكن توظيف spastin إلى جولجي أو ربما إلى الحويصلات بعد جولجي في ظل الظروف لم يحدد بعد. وتمشيا مع هذه الفكرة، معربا عن الخلايا كميات أكبر من أي atlastin الذاتية (الشكل 4 أ) أو overexpressed عرض atlastin ارتفعت مستويات ثابتة للدولة من spastin وعززت colocalization مع spastin. أدى القمع الجزئي للatlastin أيضا في انخفاض مستويات ثابتة للدولة من spastin وتوزيع الخلوية تغير أقل ما يقال في بعض الخلايا.

المواد والأساليب

ثقافة هيلا وكوس-7 خلايا وTransfections.

وكانت مزارع الخلايا وtransfections كما هو موضح في المرجع. 6. حذف بنيات YFP-spastin الأصلية (6 تم انجازه) مع نظام الطفرات QuikChange (Stratagene)، وتأكدت الطفرات من تسلسل الحمض النووي. حذف بناء ΔN الأحماض الأمينية 1-132، حذف بناء ΔMIT الأحماض الأمينية 116-194، وحذف بناء Δexon 4 الأحماض الأمينية 195-227. تم الحصول على صورة استنساخ atlastin وFLAG- أو صاحب-6X الموسومة في محطة C. لبناء atlastin C-الذيل جولجي بناء، تم إضافة البادئ الأرصاد رامزة إلى DNA ترميز atlastin C-الذيل FLAG. وتنصهر تسلسل مسؤولة عن توطين galactosyl ترانسفيراز إلى جولجي (81 بقايا N-المحطة) 3 'إلى تسلسل FLAG.

الخميرة ثنائي هجين الفرز.

تم إجراء فحص الخميرة اثنين الهجين مع النظام Clontech صانع عيدان الثقاب. تم استنساخ spastin الإنسان إلى البلازميد pGBK-T7 باستخدام تقييد مواقع NdeI وBamHI، وكان يستخدم البلازميد لتحويل سلالة AH109. وتزاوج هذه الخمائر مع سلالة Y187 التي تم pretransformed مع كدنا] مكتبة هيلا (Clontech) المستنسخة في pGAD T7 تفصيل. كانت مطلية Diploids على الثلاثي المتوسطة التسرب (منخفض اختيار صرامة)، وكانت replated ايجابيات على لوحات التسرب رباعية (الصرامة العالية) التي تحتوي على X-α-غال. تم إعداد البلازميدات من الحيوانات المستنسخة الإيجابية واستخدامها لتحويل KC8 القولونية. والتسلسل البلازميدات تعافى وretransformed إلى سلالة AH109، وكررت الفحص هجين اثنين لتأكيد أننا قد عزل البلازميدات الصحيحة.

البروتينات المؤتلف.

كان التعبير Spastin وتنقية كما هو موضح في المرجع. 6. وكان جزء ترميز C-ذيل atlastin (الأحماض الأمينية 495-558) PCR تضخيم مع الاشعال مضيفا BamHI وEcoRI تقييد مواقع للاستنساخ في pGEX2T. وأعرب عن ضريبة السلع والخدمات atlastin C-الذيل في الخلايا BL21 RILP (Stratagene) من خلال تحريض الثقافات المرحلة لوغاريتمي مع 0.4 ملي الآيزوبروبيل β- د -thiogalactoside عند 37 درجة مئوية لمدة 4 ساعات. تم تعطيل عمل خلايا غسلها، وكان تنقية البروتين GST الانصهار نفس لGST-spastin (6). تم المشقوق GST من spastin المؤتلف باستخدام البروتيني الدقة (GE للرعاية الصحية).

في المختبر MT قطع حبل.

، النظام التجاري المتعدد الأطراف استقرت التاكسول المسمى رودامين أعد كما هو موضح في المرجع 6 استخدمت (0.1 ملغ / مل تركيز النهائي) في قطع فحوصات أجريت في 25 ° C مع spastin (0.02 ملغ / مل)، وATP (1 ملم) في غياب أو وجود 10 أضعاف الزيادة المولي من atlastin C-الذيل. في بعض الأحيان هو مبين في الشكل. 2 أزيلت قسامات وثابتة في غلوتارالدهيد. وكانت مخففة العينات ورصدت على coverslips، وصورت MTS من 10 على الأقل المجالات المجهرية تم اختيارها عشوائيا ويتم قياسها باستخدام metamorph. تم تصوير حوالي 125-250 النظام التجاري المتعدد الأطراف وقياس لكل نقطة زمنية.

Coimmunoprecipitations.

و transfected خلايا هيلا في لوحات ستة جيدا لمدة 24 ساعة و lysed في RIPA العازلة (50 ملي HEPES، ودرجة الحموضة 7.4 / 100 ملي كلوريد الصوديوم / 2 مم MgCl 2/10٪ الجلسرين / 1٪ تريتون X-100 / 0.5٪ deoxycholate / 0.1 وقد تم توضيح روش العلوم التطبيقية، انديانابوليس)، ولست] بواسطة الطرد المركزي (20،000 × ز مركبات لمدة 20 دقيقة في 4 درجة مئوية)؛٪ SDS / البروتيني خليط المانع. تم precleared Supernatants مع بروتين G سيفاروز، وأضيفت 2.5 ميكروغرام من صاحب-6X الأجسام المضادة والبروتين G لمدة 1 ساعة على 4 درجات مئوية. تم غسلها حبات ثلاث مرات في المخزن RIPA ومزال في SDS عينة العازلة. جرى التحقيق لست] لspastin وatlastin التي كتبها α-HA وα صاحب الغربي النشاف، على التوالي. جرى التحقيق Immunoprecipitates عن محتوى spastin التي كتبها HA النشاف.
الأجسام المضادة والمناعي.

تم تحصين الدجاج مع GST-spastin، وكانت الأجسام المضادة تقارب-تنقيته من المستمدة من صفار IGY جزء باستخدام مصفوفة تقارب حيث ثبتوا بروتين النخاعين الأساسي (MBP) -spastin مع Affigel. تم انتشال الأجسام المضادة النقاء بتركيز 0.2 ملغ / مل وتخزينها في 50 ملي تريس (الرقم الهيدروجيني 8.0). لجعل الأجسام المضادة atlastin، تم تحصين الأرانب مع GST atlastin C-الذيل. والأجسام المضادة تنقية تقارب على مصفوفة MBP-atlastin.
الكشف عن spastin الذاتية المناعي المجهري الحجب المطلوب من خلايا الميثانول الثابتة في BlockHen II (إيفس مختبرات، تيغارد، OR) للحد من تلوين الخلفية. أيضا، تم استخدام الأجسام المضادة في 1: 5،000-1: 20،000 التخفيفات، وتضخيم إشارة مع Tyramide تضخيم إشارة كيت اليكسا فلور 488 أو فلور اليكسا 594 (المسابر الجزيئية).تم استخدام الأجسام المضادة Atlastin في 1: 500 التخفيف أو في 1: 5،000-1: 10،000 عند استخدامها مع tyramide تضخيم الإشارات. تم استخدام الأجسام المضادة في التخفيفات التالية: Yl1 / 2 (Chemicon) لتويولين في 1: 500، أرنب مكافحة FLAG (الانجذاب BioReagents، محطة Neshanic، NJ) في 1: 250، ومكافحة صاحب-6X (Clontech) في 1: 250، والماوس مكافحة GM130 (BD العلوم البيولوجية) في 1: 250، والفئران-HA المضادة (روش العلوم التطبيقية) في 1: 250. تم تنفيذ النشاف الغربي الكمي باستخدام الأجسام المضادة صبغ مترافق الأشعة تحت الحمراء الثانوية بالتزامن مع نظام الأشعة تحت الحمراء التصوير / المسح Licor الأوديسة.
رني.

وقد تحقق Spastin رني باستخدام الوجهين سيرنا (العقاقير، 5'-rArUrArCrCrArUrUrCrCrArCrArGrCrUrUrGrCrUrCrCrUrUrC rUrG-3 '؛ المعنى، 5phos-rGrArArGrGrArGrCrArArGrCrUrGrUrGrGrArArUrGrGrUAT). و transfected الخلايا مع الوجهين سيرنا في 20 نانومتر المزدوجة باستخدام Silentfect (بيو راد) لمدة 48 ساعة. تم استخدام سيرنا سارعت في نفس التركيز كعنصر تحكم (المعنى، 5phos-rCrUrUrCrCrUrCrUrCrUrUrUrCrUrCrUrCrCrCrUrUrGrUGA؛ العقاقير، rUrCrArCrArArGrGrGrArGrArGrArArArGrArGrArGrGrArArG rGrA). وقد تحقق Atlastin رني باستخدام RNA دبوس الشعر القصير (shRNA) الذي سبق ان عرضه لقمع atlastin (23). تم استنساخ عنصر تحكم shRNA إلى alphafetoprotein (GGATCTGTGCCAAGCTCAGTTCAAGAGACTGAGCTTGGCACAGATCCTT TTTT) في pLentilox (24). وكانت البلازميدات استخدام ل transfect كوس-7 الخلايا، وتم فحص خلايا 48-72 ساعة بعد ترنسفكأيشن.

 

__________________
استشارى الادوية الطبيعيه وباحث وخبير فى علاجات التوحد
رد مع اقتباس
  #15  
قديم 11-22-2015, 11:12 PM
رافت ابراهيم رافت ابراهيم غير متواجد حالياً
عضو ذهبي
 
تاريخ التسجيل: Dec 2011
المشاركات: 520
افتراضي CAG كرر التوسع في مرض وراثي جسمي النقي مشلول الشلل النصفي مرتبط الكروموسوم 2p21-P24

 


CAG كرر التوسع في مرض وراثي جسمي النقي مشلول الشلل النصفي مرتبط الكروموسوم


2p21-P24



وقد تم تحديد CAG تكرار التوسعات كما الطفرات المسببة للأمراض ديناميكية في المناطق ترميز الجينات في العديد من الاضطرابات العصبية يورث، بما في ذلك نخاعي بصلي ضمور العضلات، مرض هنتنغتون،-pallidoluysian مسنني حمراوي ضمور، النخاعي المخيخي نوع ترنح 1 و 2 و 6 و Machado- جوزيف المرض. يتم تحويل CAG تكرار التوسعات لمساحات polyglutamine ممدود وزيادة حجم الجهاز polyglutamine يرتبط بترقب، ميزة أساسية، وينظر في كل هذه الأمراض. وراثي جسمي الشلل النصفي التشنجي النقي (ADPSP) هو اضطراب تنكسي للجهاز الحركي المركزي يتميز سريريا من قبل التشنج ببطء تدريجي ومتواصل في الساقين، فرط المنعكسات وعلامة بابنسكي. مثل تكرار الأمراض CAG أنشأت يتميز ADPSP من قبل كل من الاختلاف بين وداخل الأسرة والترقب. باستخدام كرر التوسع كشف (RED) طريقة، قمنا بتحليل 21 الأفراد المتضررين من ست عائلات الدنماركية مع المرض مرتبط الكروموسوم 2p21-P24. وجدنا أن 20 من 21 أفراد المتضررين أظهر CAG تكرار التوسعات مقابل اثنين من 21 أزواج الأصحاء، مما يدل على وجود ارتباط بقوة ذات دلالة إحصائية بين حدوث توسع تكرار والمرض (اختبار فيشر، P <10 -5) مما يدل على أن تكرار CAG وتشارك التوسع يفترض بمثابة طفرة ديناميكية في ADPSP مرتبطة الكروموسوم 2p21-P24. ويقدر حجم التوسع لتكون ≥60 CAG تكرار نسخة في الأفراد المتضررين. توسيع CAG تكرار ومن المرجح جدا ترجمتها وأعرب كما يتضح من الكشف عن البروتين التي تحتوي على polyglutamine في المريض ADPSP.
مقدمة

الشلل النصفي التشنجي وراثي هو اضطراب تنكسي للجهاز الحركي المركزي يتميز سريريا من قبل التشنج ببطء تدريجي ومتواصل في الساقين، فرط المنعكسات وعلامة بابنسكي. اعتمادا على وجود علامات سريرية أخرى المسيطرة على التعاون اضطراب تقليديا ينقسم إلى مجمع وشكل نقي (1).
وراثي جسمي الشلل النصفي التشنجي النقي (ADPSP) يتميز سريريا في أواخر بداية، والتباين المشترك بين وداخل الأسرة والترقب (2). تم تعيين ثلاثة مواضع مختلفة لADPSP إلى الكروموسومات 14q11.2-q24.3 (موضع SPG3) (3)، 2p21-P24 (موضع SPG4) (4) و15q11.1 (موضع SPG6) (5) ؛ ومع ذلك، فإن المظاهر السريرية تكاد تكون متطابقة في الأسر مع موقع مختلف للجين المرض.
ترتبط CAG تكرار التوسعات مع التقدمية، في وقت متأخر من الأمراض التنكسية بداية الجهاز العصبي المركزي بما في ذلك نخاعي بصلي ضمور العضلات (SBMA) (6)، مرض هنتنغتون (HD) (7)، النخاعي المخيخي نوع ترنح 1 (SCA1) (8)، وترنح النخاعي المخيخي نوع 2 (SCA2) (9)، النخاعي المخيخي نوع ترنح 6 (SCA6) (10)، ماتشادو يوسف المرض (MJD) (11)، ومسنني حمراوي-pallidoluysian ضمور (DRPLA) (12). تقع يكرر CAG في المنطقة الترميز من الجينات المعنية والتوسعات هي من 36 إلى> 100 تكرار النسخ في الأفراد المتضررين؛ الأليلات عادية تحتوي على ما يصل إلى 40 تكرار النسخ، وترك مجموعة غير محدد من 36-40 حيث قد يحدث انخفاض انتفاذ (13). في SCA6، ومع ذلك، فإن مجموعة من (CAG) n هو 21-27 بينما الأليلات العادية تحتوي على 4-16 وحدة تكرار (10). هناك علاقة عكسية بين طول التوسع CAG والعمر عند بداية وجميع هذه الأمراض تظهر تباين ملحوظ في الأعراض وغالبا الحاضر في وقت متأخر. كما يتميز ADPSP من الاختلاف نفسه، كنا تحرض على دراسة ADPSP فيما يتعلق بحضور CAG تكرار التوسعات. استخدمنا RED (كرر التوسع الكشف) طريقة (14)، الذي يحدد تكرار التوسعات المحتملة المرضية في الجينوم، لتحليل لحدوث CAG تكرار التوسعات في الأفراد المتضررين من ست عائلات الدنماركية مع ADPSP مرتبطة الكروموسوم 2p21-P24.

النتائج

تحليل الربط الجيني تقتصر موضع ADPSP إلى الكروموسوم 2p21-P24 (SPG4) في كل من الأسر الدنماركية ستة (2). تم إجراء تحليل الأحمر على عينات من 21 أفراد المتضررين من ست عائلات مختلفة. والضوابط العادية قمنا بتحليل 21 الزوجين صحي وشمل عينة من مريض يعاني من ضمور الأحداث تأتر العضل كما تحكم إيجابية.
كانت الضوابط العادية كل فرقة من 72 سنة مضت ولكن ثلاثة منهم تحسنت RED المنتجات> 72 نقطة أساس في الحجم. كان اثنان من أفراد منتجات الحمراء من 180 سنة مضت واحد فرد منتج الأحمر من 108 سنة مضت.
أن تكون فوق عتبة المرضية من وحدات تكرار 36 CAG تنطبق على معظم الأمراض العصبية المذكورة (+6 - 11، 12)، ولكن لا يزال في الطرف الأدنى من هذه التوسعات، حددنا المنتجات RED ≥144 بي بي ~48 تكرار نسخ كما توسعت الأليلات. أظهر عشرين مريضا التوسعات كرر مقابل اثنين من 21 الضوابط العادية (10٪)، مما يدل على وجود ارتباط بقوة ذات دلالة إحصائية بين حدوث توسع تكرار والمرض (اختبار فيشر، P <10 -5) الذي يشير إلى أن تكرار توسيع CAG ويشارك في ADPSP مرتبطة الكروموسوم 2p21-P24. المقايسات من فرد واحد المتضررين مع النمط الفرداني المرض فشلت مرارا وتكرارا لإعطاء المنتج الحمراء للكشف وبالتالي فقد تم استبعاده من التحليل الإحصائي. كان جميع الأفراد المتضررين السريري داخل الأسرة نفس النمط الفرداني المرتبطة بهذا المرض (الشكل 1).
لتقدير حجم تكرار المرضية في ADPSP أدرجنا عينات من المريض MJD مع وحدات تكرار 72 CAG في أليل المرض على النحو الذي يحدده تفاعل البلمرة المتسلسل (PCR) التحليل باستخدام الاشعال MJD 25 و 52 MJD (11). وكان المنتج الحمراء للمريض MJD 216 سنة مضت ~72 CAG تكرار نسخ المقابلة لتقصي عن طريق تحليل PCR (الشكل 2، 2 لين). على افتراض أن وجود ارتباط مماثل موجود في ADPSP مرتبطة الكروموسوم 2p21-P24 وقد قدر التوسع تكرار في ADPSP أن يكون لا يقل عن 180 سنة مضت ~60 CAG تكرار النسخ كما كانت هذه الفرقة موجودة في جميع الأفراد المتضررين.
كما هو مبين في الشكل 2، وكان هناك اختلاف في حجم أعلى المنتجات الوزن الجزيئي الكشف داخل كل أسرة. ومع ذلك، لم يكن هناك ارتباط واضح بين حجم المنتج والعمر عند بداية. في الممرات 4 و 5 فرق إضافية> 252 و> 216 نقطة أساس، على التوالي، وكشف ولكن مع شدة انخفاض مقارنة مع أقل العصابات.
التحقيق في ما إذا ترجمت تكرار CAG إلى polyglutamine تحتوي على البروتينات اختبرنا lymphoblastoid خط الخلية (LCL) مقتطفات من البروتين واحد ADPSP المريض، واحد HD المريض واثنين من الضوابط العادية على لطخة غربية. عندما بحث مع الأجسام المضادة وحيدة النسيلة 1C2، الذي يعترف مساحات polyglutamine كبيرة، وهو بروتين ذات وزن جزيئي> تم الكشف عن 350 كيلو دالتون في استخراج ADPSP LCL ولكن ليس في LCL مقتطفات من الضوابط العادية (الشكل 3). شوهد البروتين كيلو دالتون ~240 في جميع العينات الثلاث. استخدمت كيلو دالتون huntingtin 350 مع توسيع 52 glutamines من استخراج البروتين الليفية كعنصر تحكم إيجابية. كان المريض ADPSP الأليلات HD في المعدل الطبيعي (14/16) (لا تظهر البيانات)، وبالتالي دون عتبة الكشف عن mAb1C2.

نقاش

مثل الاضطرابات العصبية الأخرى يورث، كل الناجمة عن التوسع CAG تكرار الديناميكي في الجينات المسببة، ADPSP هو مرض غير متجانس phenotypical تتميز كلا من بداية الراحل، والتباين المشترك بين وداخل الأسرة والترقب (2). ولذلك، درسنا ADPSP فيما يتعلق بحضور CAG تكرار التوسعات. لهذا الغرض طبقنا طريقة الأحمر إلى ست عائلات مع ADPSP مرتبطة بإحكام على كروموسوم 2p21-P24. طريقة الأحمر، الذي يحدد تكرار التوسعات المحتملة المرضية دون معرفة مسبقة من موقع الكروموسومات، وقد تم تطبيقها على الأمراض العصبية الموروثة من مجهول المكان وراثية واظهار الترقب. في الآونة الأخيرة، يندبلاد آخرون تطبيق طريقة الأحمر لثماني عائلات مع النخاعي المخيخي نوع ترنح 7، والعثور على تكرار التوسع CAG من 64 في المتوسط ​​أن يكون السبب الأكثر احتمالا لهذا المرض (15). الجمعيات بين CAG تكرار التوسعات واضطراب عاطفي ثنائي القطب (16) وكذلك مرض انفصام الشخصية (17 تم العثور أيضا) من خلال طريقة الأحمر. ومع ذلك، لم يكن هناك دليل على وجود توسع CAG تكرار المعنية كما طفرة مسببة للمرض لا في مرض عائلي باركنسون (18) ولا في الأسر التي لديها راثي التهاب الشبكية الصباغي السائد (19).
مقارنة مع المنتج الأحمر من مريض MJD مع CAG طول تكرار أحجام المنتج RED-PCR تحديد المترابطة بشكل جيد مع عدد تكرار نسخة الفعلي على النحو الذي يحدده PCR، وجود علاقة وأفيد أيضا يندبلاد وآخرون. (20). تطبيق ارتباط مماثل لأسر ADPSP هنا وأظهر تحليل المنتجات ربط ≥180 بي بي ~60 CAG تكرار النسخ في جميع الأفراد المتضررين. في تكرار غيرها من الأمراض CAG هناك علاقة عكسية بين تكرار CAG التوسع وعمر في البداية. لصالح فرضية أن هذا قد يحدث في ADPSP كذلك يبدو من F الأسرة حيث تم العثور على منتج الأحمر في أعلى الوزن الجزيئي في امرأة تبلغ من العمر 56 سنة مع التقدم في السن في بداية 10 سنة. على العكس من ذلك، تبين عكس ذلك على مدى ثلاثة أجيال من عائلة H حيث سن في بداية ينخفض ​​موازية للانخفاض في عدد من المنتجات الحمراء (الشكل 2). ولذلك، فإنه من غير الممكن من نتائجنا لجعل أي بيان واضح ما إذا كان التوسع CAG تكرار له أهمية لعمر في بداية في ADPSP.
الفرق في شدة الفرقة ينظر في الممرات واحدة مع عصابات من أعلى الوزن الجزيئي التي تظهر أضعف قد يكون راجعا إلى إنشاء عدد محدود من المنتجات من حجم أكبر من القالب المستخدم، على الأرجح بسبب الصلب الثاني من ligated بالفعل جزيئات (14). بدلا من ذلك، والفرق في شدة قد تمثل استعلاء من المنتجات من اثنين من مختلف CAG تكرار تسلسل من أطوال مختلفة (20)، وهي أطول سلسلة يجري لا علاقة للمرض، مثل تلك العصابات من انخفاض كثافة موجودة في بعض الأفراد المتضررين فقط.
وأظهرت ثلاث من 21 الضوابط العادية منتجات الحمراء> 72 نقطة أساس في الحجم. كان اثنان من أفراد التوسعات من 180 سنة مضت واحد فرد منتج الأحمر من 108 سنة مضت. Schalling وآخرون. (14) ويندبلاد وآخرون (16، 20) وصفه التوسعات في ~30٪ من السكان الطبيعي. الفرق في وتيرة التوسع في الضوابط العادية في الدراسات وربما يرجع ذلك إلى عدد صغير نسبيا من الضوابط وبالتأكيد لا تعتمد على الاختلاف البيولوجي الحقيقي في مجموعات.
في HD، DRPLA، SBMA، SCA1، SCA2، SCA6 وMJD، يتم تحويل CAG تكرار التوسعات في مساحات polyglutamine (9، 10، 21)، والتي يعتقد أنها تؤدي إلى تحقيق مكاسب من وظيفة من البروتينات المتحورة. تروتييه وآخرون. (22) ميزت mAb1C2 الأجسام المضادة التي تعترف التوسعات polyglutamine في البروتينات المرضية المتورطين في HD، SCA1، MJD، SCA2 وSCA7 (22، 23). باستخدام هذه الأجسام المضادة وجدنا البروتين ذات وزن جزيئي فوق 350 كيلو دالتون في مقتطفات LCL من مريض واحد ADPSP. تروتييه وآخرون. (22) لم تجد دليلا للتوسعات polyglutamine في المرضى الذين يعانون ADPSP لا في الأسر مع المرض مرتبط كروموسوم 2 ولا في الأسر التي ليست مرتبطة المرض إلى كروموسوم 2. ومع ذلك، فإن mAb1C2 فقط بالكشف عن التوسعات polyglutamine فوق عتبة معينة وحد الكشف يختلف وفقا للبروتين، ويتضح من عتبة تحور HD بروتين يجري 39 glutamines مقارنة مع الحد من الكشف عن البروتين SCA1 من 55 glutamines (22). توسعات Polyglutamine دون عتبة "محددة" في المرضى ADPSP التحقيق قد يكون تفسيرا لماذا تروتييه وآخرون لم تجد دليلا للتوسعات polyglutamine؛ ولكن هناك ما يبرر إجراء مزيد من التحليل للمادة أكبر لتحديد ما إذا كان هناك ارتباط بين> 350 كيلو دالتون البروتين والنمط الظاهري ADPSP.

الشكل 1
الأنساب تظهر أجزاء من الأسر F وH مع ADPSP. أسفل كل النسخ المتنوعة الفردية شيدت من علامات الصبغي 2p21-P24 D2S400، D2S352، D2S2351، D2S2374، وD2S367 ترد. يظهر النمط الفرداني المرتبطة بهذا المرض مع أشرطة سوداء. كان جميع الأفراد المتضررين أحمر المنتج> 144 سنة مضت (باستثناء III-3 من أسرة H، الذي فشل مرارا وتكرارا لإعطاء المنتج الحمراء للكشف وبالتالي تم استبعادها من التحليل الإحصائي). IV-1، IV-2 وIV-3 من العائلة F هم جميع الأطفال دون سن 10 عاما. لم يتم تنفيذ تحليل الأحمر في أولئك الأفراد كما كانت كمية DNA صغيرة جدا للتحاليل.


الرقم 2
صورة الإشعاع الذاتي من المنتجات الأحمر من أجزاء من الأسر ADPSP H وF باستخدام (CTG) 12 النوكليوتيد. تشير الأرقام العمر عند بداية. أدنى الفرقة في كل حارة تمثل ربط منتج واحد = 72 قواعد ~24 CAG تكرار النسخ. كل فرقة إضافية تمثل 36 قواعد إضافية الموافق المشارك ربط واحد إضافي (CTG) 12. حارة 1: تأتر العضل الأحداث ضمور المريض. حارة 2: المريض MJD. (PCR تحديد CAG تكرار حجم = 72.) لين 3: الزوج تتأثر. الممرات 4-6: ثلاثة مرضى ADPSP من H. الأسرة الممرات 7-10: أربعة مرضى ADPSP من عائلة F.


الشكل (3)
اثنين من البقع الغربية من مستخلصات البروتين من أحد ADPSP LCL، وهما LCLs التحكم العادي واستخراج البروتين الليفية من مريض يعانون من مرض هنتنغتون (HD). حارة 1 + 6: استخراج LCL من الضابطة (N1). لين 2 + 5: استخراج LCL من المريض ADPSP. حارة 3: استخراج LCL من الضابطة (N2)، لين 4: الخلايا الليفية استخراج من HD المريض. شوهد البروتين كيلو دالتون ~240 في جميع مقتطفات LCL، ولكن البروتين كيلو دالتون> 350 تم الكشف فقط في LCL مقتطفات من المريض ADPSP. وقد استخدم شكل مرضي من 350 كيلو دالتون HD البروتين مع توسيع 52 glutamines عن السيطرة الإيجابية.

في الختام، أنشأنا علاقة بين التوسع CAG تكرار وADPSP مرتبطة الكروموسوم 2p21-P24. ومن المفترض أن تشارك التوسع في آلية المرض كما طفرة ديناميكية تقع في المنطقة ترميز الجين. كما يدل على ذلك mAb1C2 تحليل تكرار التوسع CAG من المرجح جدا ترجمتها وكنسبة المسالك polyglutamine في البروتين المرضية.

المواد والأساليب

الأسر

تم التشخيص على أساس وجود تاريخ عائلي موثقة جيدا ومعايير التشخيص من هاردينغ (1). وكانت معايير الحد الأدنى للتشخيص التشنج في الأطراف السفلية، عادة أكثر وضوحا من الضعف، وردود الفعل وتر مفرط وعلامة بابنسكي. يتم إعطاء البيانات السريرية وتفاصيل العائلة في مكان آخر (2). تم فحص واحد وعشرين الأفراد المتضررين من ست عائلات الدنماركية مع ADPSP و 21 الزوجين تتأثر.

تحليل الأحمر

تم استخراج DNA الجينومية باستخدام الإجراء التمليح من ميلر وآخرون. (24). وقد أجريت جميع ردود الفعل على نظام بيركن إلمر GeneAmp PCR 2400، وذلك باستخدام الشروط التالية مع بعض التعديلات من Schalling وآخرون. (14) ويندبلاد وآخرون. (20).
قبل رد الفعل ربط ل(CTG) 12 النوكليوتيد (فارماسيا في مجال التكنولوجيا الحيوية) وفسفرته باستخدام dATP وكيناز عديد النوكليوتيد (فارماسيا في مجال التكنولوجيا الحيوية). ردود الفعل ربط (20 ميكرولتر) يحتوي على 4 ميكروغرام من الحمض النووي الجيني، 50 نانوغرام من 5'ذا الصلة، phosphory (CTG) وحضنت 12 النوكليوتيد و5 U PFU DNA يغاز (Stratagene) مع يغاز العازلة توفيره في البداية في 94 درجة مئوية لمدة 5 دقيقة. وبعد ذلك تعرضوا ل495 دورات من 80 درجة Cfor 30 ثانية و 94 درجة مئوية لمدة 10 ثانية. تم التشويه والتحريف المنتجات ربط في 50٪ الفورماميد لمدة 5 دقائق قبل الكهربائي على هلام 6٪ بولي أكريلاميد تغيير طبيعة / 6 M اليوريا. وelectrotransferred الحمض النووي في وقت لاحق (شركة CBS العلمي، نظام النشاف شبه الجافة، EBU-6000) على Hybond N + غشاء باستخدام 175 مللي أمبير لمدة 20 ساعة في 1 × TBE. بعد UV-IMMOBIL-سعودة، تم تهجين الأغشية لمدة 20 ساعة عند 65 ° C إلى (CAG) 10 [32 P] -labeled النوكليوتيد التحقيق باستخدام 3 DNA "نهاية نظام الترقيم (PROMEGA). وجرفت المياه الأغشية في 2 × SSC، 0.1٪ SDS لمدة 45 دقيقة في 40 ° C 1 × SSC، 0.1٪ SDS لمدة 45 دقيقة في 63 ° C 0.1 × SSC، 0.1٪ SDS لمدة 45 دقيقة في 63 ° C وautoradiographed ل1 -3 أيام باستخدام شاشة تكثيف. وقد أجريت فحوصات الحمراء مرتين على الأقل لكل عينة DNA.
كانت الظروف النشاف الأساسية لاستنساخ أعلى العصابات الوزن الجزيئي.

تحليل صلة

تم احتساب النتيجة متعددة اللد مع علامات وضعه وفقا لخريطة Généthon بالقرب من مكان 2p21-P24 (SPG4) (25). كانت علامات والمسافات (سم) المستخدمة لتحليل متعددة: D2S400- (0.0) -D2S352- (0.01) -D2S2351- (0.01) -D2S2374- (0.0) -D2S367. تم إجراء التحليل الربط متعددة الأطراف باستخدام برنامج LINKMAP من حزمة FASTLINK (26).

استخراج البروتين وصمة عار الغربية

تم استخراج البروتينات من الابيضاض اللمفاوي والخلايا الليفية صوتنة في 50 ملي تريس، حمض الهيدروكلوريك درجة الحموضة 7.8، 10٪ (ت / ت) الجلسرين، 1 ملم EDTA، 5 ملي بوكل، 1 ملم phenylmethylsulfonyl الفلوريد، 10 ميكروغرام / leupeptin مل و 10 ميكروغرام / مل aprotenin. بعد الطرد المركزي في 000 15 جرام لمدة 15 دقيقة في 4 درجات مئوية، وجمعت طاف وتركيز البروتين يحدده الفحص BCA (بيرس). تم فصل عينات البروتين (50 ميكروغرام / حارة) من قبل 5٪ SDS-PAGE (27) والرطب نشف لImmobilon P غشاء (ميليبور) (28). وأغلقت الأغشية في الفوسفات مخزنة المالحة مع 5٪ الحليب المجفف منزوع الدسم وimmunoprobed مع الأجسام المضادة وحيدة النسيلة 1C2 (20). وقد وضعت البقع باستخدام الفجل البيروكسيداز مترافق أمصال مضادة لمكافحة فأر (داكو) وتعزيز لمعان كيميائي (ECL طقم، أمرشام).

التحليل الاحصائي

واستخدمت عصابة من 72 سنة مضت والتي تتطابق مع اثنين ligated (CTG) 12 [أليغنوكليوتيد كعنصر تحكم للمقايسة الأحمر. كما ذكرت من قبل Schalling وآخرون. (14) هذا المنتج على الأرجح يمثل عملية ربط لعدة تكرار قصيرة مواضع في الجينوم، وبالتالي يجب أن تكون موجودة في كل فرد. وقد تم تحديد المنتجات الحمراء من 144 سنة مضت ~48 CAG تكرار نسخ أو multimers العليا من ركائز ربط باعتبارها أليل الموسعة. تم استخدام اختبار فيشر في جدول 2 × 2 لاختبار فرضية وجود علاقة بين تكرار التوسع والمرض.

 

__________________
استشارى الادوية الطبيعيه وباحث وخبير فى علاجات التوحد
رد مع اقتباس
  #16  
قديم 11-22-2015, 11:24 PM
رافت ابراهيم رافت ابراهيم غير متواجد حالياً
عضو ذهبي
 
تاريخ التسجيل: Dec 2011
المشاركات: 520
افتراضي A الجينوم على نطاق إصلاح الحمض النووي رني الشاشة يحدد spg48 بوصفها رواية جين المصاحبة راثي مشلول الشلل النصفي

 

http://journals.plos.org/plosbiology...l.pbio.1000408




ملخص

إصلاح الحمض النووي أمر ضروري للحفاظ على سلامة الجينوم، وكثيرا ما تحور الجينات مع أدوار في إصلاح الحمض النووي في مجموعة متنوعة من الأمراض التي تصيب الإنسان. إصلاح عبر إعادة التركيب مثلي عادة يعيد تسلسل الحمض النووي الأصلي دون طفرات إدخال، وعدد من الجينات التي مطلوبة من أجل DNA إعادة التركيب مثلي مزدوج الجديلة إصلاح انقطاع (HR-DSBR) تم تحديدها. ومع ذلك، لم يتم الإبلاغ عن تحليل منهجي لهذا المسار المهم إصلاح الحمض النووي في خلايا الثدييات. هنا، نحن تصف باختصار التدخل RNA (esiRNA) الشاشة عن الجينات المسؤولة في الحمض النووي حبلا مزدوجة إصلاح كسر الجينوم على نطاق إعداد endoribonuclease. نفيدكم 61 الجينات التي تتأثر وتيرة HR-DSBR وتميز في التفاصيل واحدة من الجينات التي انخفضت وتيرة HR-DSBR. وتبين لنا أن KIAA0415 الجين يشفر helicase المفترض أن يتفاعل مع SPG11 وSPG15، اثنين من البروتينات المتحورة في الشلل النصفي التشنجي وراثي (HSP). نحن تحديد الطفرات في المرضى الذين يعانون HSP، واكتشاف KIAA0415 / SPG48 باسم الجينات رواية HSP المصاحب، وتبين أن KIAA0415 / SPG48 خط خلية متحولة هو أكثر حساسية لDNA إتلاف المخدرات. نقدم مسح الجينوم على نطاق والعشرين من HR-DSBR في خلايا الثدييات توفير مجموعة البيانات التي يجب الإسراع في اكتشاف جينات جديدة مع أدوار في إصلاح الحمض النووي والظروف الطبية المرتبطة بها. يطلب من اكتشاف أن البروتينات تشكيل مجمع البروتين رواية لكفاءة HR-DSBR وتحور في المرضى الذين يعانون من HSP يشير إلى وجود صلة بين HSP وإصلاح الحمض النووي.

الكاتب موجز

جميع الخلايا في أجسامنا لديها للتعامل مع آفات عديدة لالحمض النووي. الخلايا تستخدم بطارية من الجينات لإصلاح الحمض النووي والحفاظ على سلامة الجينوم. ونظرا لأهمية وجود الجينوم سليمة، فإنه ليس من المستغرب أن الجينات مع أدوار في إصلاح الحمض النووي وتحور في كثير من الأمراض التي تصيب الإنسان. هنا، فإننا نقدم نتائج شاشة إصلاح الحمض النووي الجينوم النطاق في الخلايا البشرية واكتشاف 61 الجينات التي لها دور محتمل في هذه العملية. درسنا بالتفصيل جين لم يسبق توصيفها (KIAA0415 / SPG48) وأثبتت أهميتها لDNA كفاءة حبلا مزدوجة إصلاح كسر. وكشفت التحليلات المزيد من الطفرات في الجين SPG48 في بعض المرضى الذين يعانون من الشلل النصفي التشنجي وراثي (HSP). أظهرنا أن SPG48 يتفاعل جسديا مع البروتينات HSP الأخرى وأن خلايا المرضى حساسون لDNA إتلاف المخدرات. وتشير البيانات المتوفرة لدينا وجود صلة بين HSP وإصلاح الحمض النووي ونقترح أن المرضى HSP يجب فحص للطفرات KIAA0415 / SPG48 في المستقبل.

الأرقام




























الاقتباس: Słabicki M، ثيس M، كراستيف DB، سامسونوف S، Mundwiller E، خوانكويرا M، وآخرون. (2010) A الجينوم على نطاق إصلاح الحمض النووي رني الشاشة يحدد SPG48 بوصفها رواية جين المصاحبة راثي مشلول الشلل النصفي. بلوس بيول 8 (6): e1000408. دوى: 10.1371 / journal.pbio.1000408
محرر الأكاديمية: نيكولاس هاستي، وحدة مجلس البحوث الطبية علم الوراثة البشرية، المملكة المتحدة
وردت: 12 مارس 2010؛ المقبولة: 19 مايو، 2010؛ تاريخ النشر: 29 يونيو 2010
حقوق النشر: © 2010 Słabicki وآخرون. هذا هو مقال الوصول المفتوح زعت بموجب شروط رخصة المشاع الإبداعي العزو، الذي يسمح بالاستخدام غير المقيد، والتوزيع، والاستنساخ في أي وسيط، بشرط تقيد المؤلف الأصلي والمصدر.
التمويل: تم تمويل هذه الدراسة من قبل جمعية ماكس بلانك (لFB، AS)؛ من قبل الوزارة الاتحادية الألمانية للتعليم والبحوث يمنح الذهاب الحيوية [0315105] (لFB)، NGFN زائد [01GS0859] (لFB)؛ من قبل كلاوس Tschira ستيفتونغ المحدودة (لJT، SS، والخطة المتوسطة الأجل)؛ من قبل المعاهد الوطنية للصحة NIGMS منح 1R01GM070986-01A1 (لAS)؛ من المنحة EUROSPA كونسورتيوم الاتحاد الأوروبي (لAB)؛ من قبل الوكالة الوطنية الفرنسية للبحوث يمنح ANR-SPG11 (لGS) وANR-SPAX (إلى AD)؛ وقبل عقدي الأساس (لAB). كان الممولين أي دور في تصميم الدراسة وجمع البيانات وتحليلها، قرار نشر أو إعداد المخطوطة.
تضارب المصالح: قد أعلن المؤلفان أن لا المصالح المتنافسة موجودة.
الاختصارات: BAC، كروموسوم اصطناعي البكتيرية. BER، قاعدة إصلاح الختان. PDB، بروكهافن بروتين بنك المعلومات. جهاز تسوية المنازعات، وضعف كسر حبلا؛ HSP، الشلل النصفي التشنجي راثي؛ الأشعة تحت الحمراء، الأشعة المؤينة. LOH، وفقدان تغاير؛ MMC، ميتوميسين C؛ NER، النوكليوتيدات إصلاح الختان. NHEJ، نهاية امتماثلان الانضمام. PFA، لامتصاص العرق. Rluc، renilla luciferase المراسل. TCC، الإحضار رقيقة الثفني

مقدمة

ترتبط طفرات في الجينات DNA إصلاح يعانون من أمراض واضطرابات مختلفة بما في ذلك السرطان [1]، تسارع الشيخوخة [2]، وتنكس الخلايا العصبية [3]. تظهر الخلايا العصبية لتكون عرضة للطفرات في الجينات إصلاح الحمض النووي، وربما يعود ذلك إلى عدم الانتشار والاكسدة العالية داخل هذه الخلايا. ونتيجة لذلك، وقد تم ربط العديد من الأمراض العصبية عيوب في إصلاح الحمض النووي مثل رنح توسع الشعيرات [4]، وترنح توسع الشعيرات مثل اضطراب [5]، ومتلازمة سيكيل [6]، ومتلازمة الكسر نيميجن [7]، وCharcot- متلازمة ماري توث [8].
A الآفة DNA خطيرة ولا سيما بالنسبة للخلية هو كسر حبلا مزدوجة (DSB)، التي يتم فيها كسر نوعين من الحمض النووي على مقربة من بعضها البعض [9]، [10]. يتم إصلاح DSBs أساسا عن طريق مسارين متوازيين: إعادة التركيب مثلي ونهاية امتماثلان الانضمام (NHEJ). إصلاح عبر إعادة التركيب مثلي يعيد عادة المعلومات الجينية، في حين إصلاح عبر NHEJ غالبا ما يؤدي إلى حدوث طفرات [10]، [11].
في الآونة الأخيرة، وقد تناولت عدة شاشات رني مختلف جوانب إصلاح الحمض النووي الثدييات، مثل زيادة الحساسية تجاه PARP تثبيط [12]، وزيادة الحساسية تجاه سيسبلاتين [13]، وتراكم 53BP1 بؤر [14]، [15]، أو الفسفرة غيرت من هيستون البديل H2AX [8]. هذه الشاشات قد تتعزز بشكل كبير من فهمنا للعمليات إصلاح الحمض النووي الإنسان وتسليم عدد من جينات جديدة متورطة في مختلف جوانب إصلاح الحمض النووي. هنا، ونحن التقرير شاشة رني الجينوم على نطاق وللجينات المتورطين في مثلي بوساطة إعادة التركيب إصلاح جهاز تسوية المنازعات، كشف مجموعة متنوعة من الجينات المعروفة وذلك uncharacterized الآن المتورطين في هذه العملية. في هذا العمل، ونحن تلغيم هذه الشاشة تستخدم نهج المعلوماتية الحيوية الهيكلية وتحديد KIAA0415 / SPG48 باعتباره helicase المفترض أن يرتبط الشلل النصفي التشنجي وراثي (HSP).

النتائج

الجينوم على نطاق رني الشاشة

للبحث شامل من الجينات المرتبطة مع DNA DSB إصلاح، أجرينا شاشة رني الجينوم على نطاق، وذلك باستخدام وباختصار التدخل RNA (esiRNA) مكتبة أعد endoribonuclease [16] وتوظيف راسخة DR-GFP فحص [17]. أولا، تم إنشاء خط ثابت الخلية هيلا مع اثنين من الأليلات GFP غير وظيفية، التي يتم تفعيلها GFP التعبير بكفاءة إلا بعد HR-DSBR (الشكل 1A). ثم اختبرنا متانة فحص من قبل المشارك ترنسفكأيشن هذه الخلايا مع I-SCEI التعبير البلازميد وesiRNA استهداف Rad51، وهو عامل أساسي لتنفيذ المراحل الأولى من الاقتران مثلي وتبادل حبلا [18]. أدى استنزاف Rad51 إلى انخفاض ملحوظ للخلايا إيجابية GFP، واقترحت مقارنات لمراقبة الخلايا السلبية transfected مجموعة ديناميكية عالية للعوامل المؤثرة مرشح HR-DSBR (1B الشكل ورسوم بيانية الشكل 1C).

تحميل:
الشكل 1. الجينوم على نطاق الشاشة HR-DSBR esiRNA.

(A) تمثيل تخطيطي للمقايسة DR-GFP. وتظهر أليلين GFP غير وظيفية وموقع قطع I-SCEI. ويرد البلازميد transfected ترميز نوكلياز داخلية I-SCEI كدائرة حمراء. يظهر الجين GFP الوظيفي الذي تم إنشاؤه بعد نجاح HR-DSBR باللون الأخضر. (ب) تحليل المناعي من خط الخلية DR-GFP هيلا بعد ترنسفكأيشن مع أو بدون نوكلياز داخلية البلازميد I-SCEI وأشار esiRNAs. الحانات النطاق تمثل 10 ميكرومتر. (C) تحليل لوحة سبيل المثال من الشاشة. الآبار رمادي تشير knockdowns التي لم تتغير بشكل ملحوظ في النسبة المئوية للخلايا إيجابية GFP لاحظ، والآبار حمراء وخضراء دلالة knockdowns إنخفاضا أو زيادة النسب المئوية للخلايا إيجابية GFP لاحظ، على التوالي. يتم وضع علامة آبار المراقبة مع إطارات سوداء. على كل لوحة كانت هناك أربع الضوابط الإيجابية (esiRNA استهداف Rad51) وثمانية ضوابط السلبية (esiRNA ضد Rluc - renilla luciferase المراسل). وتعرض رسوم بيانية سبيل المثال FACS لtransfections السيطرة. (D) نقطة مؤامرة من الشاشة الرئيسية. يتم عرض النتائج على هيئة متوسط ​​عشرات من ض المستمدة من اثنين مكررات مستقلة. وترد Knockdowns مع ض عشرات أدناه -2 أو أعلى 2 باللون الأحمر أو الأخضر، على التوالي. (E) نتائج تحليل الأنطولوجيا الجينات التخصيب لالأساسي (أسود) والتحقق من صحتها (الرمادي) يضرب.
دوى: 10.1371 / journal.pbio.1000408.g001

وقد أجريت الشاشة رني من نسختين في لوحات 384 بشكل جيد من قبل المشارك ترنسفكأيشن من الترميز البلازميد I-SCEI مع esiRNAs الفردي يستهدف أكثر من 16،000 الجينات البشرية [16]. تم تحديد النسبة المئوية للخلايا إيجابية GFP بواسطة FACS إنتاجية عالية، وتوفير قراءات حساسة للesiRNAs التأثير على وتيرة HR-DSBR (الشكل 1C). ضربة قاضية من 228 و 141 محاضر انخفضت بشكل ملحوظ أو زيادة النسبة المئوية للخلايا إيجابية GFP، على التوالي (الشكل 1D، الجدول S1). من بين أقوى knockdowns تؤثر HR-DSBR كانت الجينات مع الأدوار تتميز جيدا في إصلاح الحمض النووي مثل Rad51، BRCA1، وSHFM1. وكشف تحليل الجينات تخصيب الأنطولوجيا من المرشحين لتخصيب 5 أضعاف عن الجينات ذكرت أن المتورطين في إصلاح الحمض النووي (الشكل 1E)، مؤكدا أن الشاشة كانت فعالة.
ضرب التحقق

للتحقق من صحة يضرب مرشح درسنا التعبير عنها في خلايا هيلا وresynthesized جميع esiRNAs عن الجينات التي تم التعبير عنها. نحن أيضا ولدت esiRNA الثانية، مستقلة، وغير متداخلة لهذه الجينات واختبار جميع esiRNAs مرة أخرى في مقايسة DR-GFP في مكررات متعددة. باستخدام معايير اختيار صارمة (انظر طرق أون لاين)، انخفضت 45 الجينات وتيرة إعادة التركيب مثلي، في حين زادت عليه 17 الجينات مع اثنين من المشغلات إسكات المستقلة (الجدول 1). لمزيد من تضييق قائمة من هؤلاء المرشحين 62، اختبرنا esiRNAs لتأثيرها على مستويات GFP الخلايا. EsiRNAs التي تؤثر على مستويات GFP، على سبيل المثال من خلال استهداف المنشط النسخي لGFP التعبير، يمكن أن يسجل في مقايسة DR-GFP وتلوث قائمة الاغتيالات. وبالتالي فإننا transfected في esiRNAs إلى GFP معربا عن الخلايا هيلا ويعاير مستويات GFP بواسطة FACS. انخفاض EsiRNAs استهداف MKNK2 مستويات GFP في هذه الخلايا. لذلك، تم استبعاد هذا الجين من مزيد من التحليل، والحد من القائمة النهائية لضرب 61 الجينات (الجدول 1). تم رصد فعالية هذا التحقق صرامة مرة أخرى عن طريق تحليل تخصيب الأنطولوجيا الجينات، مع إثراء الآن 20 ضعفا عن الجينات المشروح في إصلاح الحمض النووي فئة (الشكل 1E).

تحميل:
الجدول 1. ملخص البيانات المظهرية من الجينات المرشحة المتورطين في HR-DSBR.
دوى: 10.1371 / journal.pbio.1000408.t001
Knockdowns أن زيادة تواتر HR-DSBR

إسكات 17 الجينات زيادة كبيرة في عدد الخلايا إيجابية GFP في مقايسة DR-GFP. وبالتالي، فإن ضربة قاضية من هذه الجينات روجت HR-DSBR، والتي قد تكون ذات فائدة لعدة تطبيقات بيولوجية مثل زيادة كفاءة استهداف الجينات إعادة التركيب مثلي [19]. قد يفسر أسباب مختلفة لزيادة عدد الخلايا إيجابية GFP الملاحظة. أحد الاحتمالات هو أن ضربة قاضية أدت إلى تثبيط مسار NHEJ، وبالتالي تحويل نسبة من اثنين من المسارات الممكنة نحو الإصلاح عبر HR. الدعم لهذا المنطق يأتي من التجارب في الخميرة والذباب، حيث خروج المغلوب من يغاز DNA IV، وهو الجين الذي هو مطلوب لNHEJ [20]، زيادة كبيرة استهداف الجينات بإتحاد مثلي [21]، [22]. ومن المثير للاهتمام، أسفرت ضربة قاضية من Lig4 الإنسان في زيادة مذهلة في الخلايا إيجابية GFP في مقايسة DR-GFP (الجدول 1)، مما يدل على أن تثبيط مسار NHEJ يمكن أن تزيد من وتيرة HR-DSBR أيضا في خلايا الثدييات. ويدعم هذه الفكرة أيضا عن طريق التفتيش وغيرها من البروتينات NHEJ المعروفة، بما في ذلك XRCC4، XRCC5، XRCC6، PRKDC، وDCLRE1C [23]، [24]. ضربة قاضية من كل من هذه البروتينات زادت وتيرة إعادة التركيب مثلي في مقايسة DR-GFP (الجدول S1). وبالتالي، فإننا نفترض أن جينات أخرى أن زيادة عدد الخلايا إيجابية GFP قد تكون متورطة في مسار NHEJ وأن ضربة قاضية من هذه الجينات يمكن أن يعزز استهداف الجينات بإتحاد مثلي في خلايا الثدييات.
Knockdowns إنخفاضا تواتر HR-DSBR

وقد أثرى قائمة من الجينات التي انخفضت وتيرة HR-DSBR للبروتينات مع أدوار محددة جيدا في HR-DSBR، مثل Rad51 وBRCA1. وبالإضافة إلى ذلك، تم تحديد الجينات، مثل E2F1، التي تؤثر بصورة غير مباشرة HR-DSBR أيضا في الشاشة. وتشارك E2F1 في دورة الخلية وتنظيم موت الخلايا المبرمج بعد التلف في الحمض النووي [25] ولقد تم مؤخرا تورط في تنظيم النسخي من Rad51 وBRCA1 [26] ربما يفسر لماذا سجل، وضربة قاضية من E2F1 في الشاشة لدينا. ومن المثير للاهتمام، كشف الفحص أيضا عددا من الجينات التي لها دور في عمليات إصلاح الحمض النووي غير HR-DSBR، مثل XPC، التي لها دور في إصلاح الختان النوكليوتيدات (NER) [27]، وإصلاح قاعدة الختان (BER) الحمض النووي helicase RECQL4 [28]. ومع ذلك، فقد تم مؤخرا أظهرت تعدد الأشكال في الجين XPC لربط مع الانحرافات الكروموسومية التي يسببها بليوميسين [29]، وقد ذكرت RECQL4 ليتزامن مع البؤر التي شكلتها Rad51 بعد تحريض DSBs [30]، مما يشير إلى احتمال وجود صلة بين مختلف مسارات إصلاح الحمض النووي. وأخيرا، وأثرى قائمة الجينات لمفارز proteasome و، بما في ذلك PSMD4، PSMD1، PSMD14، وSHFM1. وقد أظهرت المعاملة مع مثبطات proteasome وقمع تحديدا HR-DSBR ربما بسبب عدم وجود تدهور بوساطة proteasome والكروماتين ملزمة البروتينات عرقلة الوصول إلى الآفة [31]، [32]. وعلاوة على ذلك، وقد تبين SHFM1 لازما لRad51 تشكيل بؤر على الحمض النووي من التلف [33]، تورط دورا أكثر مباشرة من هذا proteasome وحدة فرعية في HR-DSBR وربما تقديم تفسير لماذا كان SHFM1 واحدة من أقوى الضربات في الشاشة لدينا. وبناء على هذه النتائج التي تم تشجيعهم على مواصلة التحقيق في knockdowns إنخفاضا في عدد الخلايا إيجابية GFP في مقايسة DR-GFP.
لوصف بالتفصيل 44 knockdowns إنخفاضا وتيرة HR-DSBR، أجرينا عدة فحوصات إضافية. أولا، نحن اختبار تأثير على بقاء الخلية من هذه esiRNAs في خلايا هيلا. انخفض ثلاثة عشر esiRNAs كبير أعداد الخلايا واستبعدت من إجراء المزيد من التحليلات (الجدول 1). ثانيا، أجرينا ميتوميسين C (MMC)، سيسبلاتين، والإشعاع المؤين (IR) فحوصات الحساسية. MMC يؤدي في الغالب interstrand عبر وصلات، والتي تؤدي، من بين أمور أخرى، في DSBs بسبب كتلة من تكرار الشوك [34]. الأضرار سيسبلاتين DNA بطريقة مختلفة ويولد في الغالب intrastrand وصلات عبر [35]، في حين IR يؤدي إلى مجموعة متنوعة من آفات الحمض النووي [36]. الخلايا مع ضعف مسارات إصلاح الحمض النووي قد تكون أكثر حساسية لهذه العلاجات، والتي ينبغي أن تظهر في انخفاض بقاء الخلية. أربع وعشرين ساعة بعد ترنسفكأيشن من esiRNAs، تم علاج الخلايا لمدة 1 ساعة مع MMC، سيسبلاتين، أو تعرض لIR واحصي الخلايا بعد الحضانة إضافية لمدة 48 ساعة. زاد عدد من knockdowns حساسية تجاه العلاجات واحد أو أكثر، تثبت دور هذه الجينات في إصلاح الحمض النووي، مع بعض knockdowns يظهر له أثر واحد، ولكن ليس العلاج الأخرى (الشكل 2A، الجدول 1). على سبيل المثال، ضربة قاضية لRBBP8 (المعروف أيضا باسم CtIP)، الذي يعزز نهاية DNA استئصال [37]، لم يسبب زيادة الحساسية تجاه سيسبلاتين. ومع ذلك، احصي الخلايا أقل بكثير بعد العلاج MMC، مشيرا إلى أن نضوب RBBP8 توعية في المقام الأول الخلايا ضد هذا الدواء. ثالثا، قمنا بتوظيف غاما H2AX إزالة الفحص. وفسفرته في H2AX هيستون على سيرين 139 في الغالب عن طريق الصراف الآلي / ATR [38]، [39] في مواقع DSBs حتى يتم إصلاح الآفة. بعد إصلاح الحمض النووي الناجح هو عاد هذا الفسفرة من قبل PP2A الفوسفاتيز [40]. أسفرت عدة knockdowns في فترة طويلة قبل إزالة غاما H2AX من الخلايا المشع (الشكل 2B، الجدول 1)، مما يشير إلى التأخير في DSBR، وربما يفسر الانخفاض الملحوظ للخلايا إيجابية GFP في مقايسة DR-GFP. والمثير للدهشة، أظهرت بضع knockdowns خفضت بشكل عام عدد الخلايا إيجابية غاما H2AX، أو تسارع إزالة غاما H2AX بعد التشعيع. على سبيل المثال، أدى استنزاف ARHGEF1 في انخفاض عدد خلايا إيجابية غاما H2AX 1 ساعة بعد التشعيع (الشكل 2B). يحتمل، وهذا رو تبادل جوانين النوكليوتيدات عامل [41] مطلوب للتجنيد كفاءة من عوامل الفسفرة H2AX، الذي يترجم في النهاية إلى أقل كفاءة HR-DSBR. في المقابل، فإن ضربة قاضية من FIZ1، وهو Flt3 التفاعل الزنك البروتين إصبع [42]، أسفرت عن أعداد مماثلة من أشعة غاما H2AX خلايا إيجابية 1 ساعة بعد التشعيع بالمقارنة مع الخلايا السيطرة transfected. ومع ذلك، تم إزالة غاما H2AX بسرعة أكبر في هذه الخلايا (الشكل 2B)، ويحتمل المساومة DSBR فعال. معا، وهذه النتائج تعد تصديقا فعالية الشاشة لدينا وتكون بمثابة تصنيف الأولي من المسارات الجزيئية لعدد من الجينات التي يمكن استكشافها في الدراسات المستقبلية.

تحميل:
الشكل 2. فحوصات الثانوية للجينات التي تقلل من تكرار HR-DSBR.

(A) تأثير على بقاء الخلية بعد ترنسفكأيشن من esiRNAs أشار (أسود) بالاشتراك مع سيسبلاتين (رمادي غامق)، MMC (رمادي فاتح)، والأشعة تحت الحمراء (أبيض) معاملة ترد. أشرطة الخطأ تشير إلى الانحراف المعياري. وتم تطبيع كل النتائج إلى esiRNA ضد transfections Rluc. (B) تأثير على المئة من gammaH2AX خلايا إيجابية بعد ترنسفكأيشن من esiRNAs أشار دون التشعيع (أسود)، 1 ساعة بعد التشعيع (رمادي غامق)، و 6 ساعة بعد التشعيع (رمادي فاتح). أشرطة الخطأ تشير إلى الانحراف المعياري.
دوى: 10.1371 / journal.pbio.1000408.g002
KIAA0415 هل لالمزعومين Helicase المطلوبة لكفاءة HR-DSBR

لهذا العمل، ونحن الملغومة الشاشة عن طريق إجراء تحاليل المعلوماتية الحيوية على تسلسل uncharacterized في محاولة للكشف عن وظائف الجزيئية الممكنة. ظهرت KIAA0415 بوصفها ملحوظا بوجه خاص. من خلال تطبيق تقنيات خيوط (انظر طرق على الانترنت لمزيد من التفاصيل)، حددنا homologies الهيكلية المحتملة للKIAA0415 مع البروتينات التي تنتمي إلى عائلة أضعاف "P-حلقة تحتوي على hydrolases ثلاثي الفوسفات نوكليوزيد" (SCOP c.37؛ الجدول S2).تحتوي هذه العائلة أضعاف ما يسمى ب "helicase C نطاق" (PF00271) التي شكلتها تكرار جنبا إلى جنب اثنين من المجالات RECA مثل (جنبا إلى جنب AAA-أتباز الفصيلة). وقد تم الحصول على أعلى الدرجات تسلسل إلى بنية التحالفات مع تسلسل KIAA0415 وهيكل المجالات helicase C من helicases SF2 التي تشارك في إصلاح الحمض النووي مثل UvrB، Hel308، RecG، وTRCF (الشكل 3). الفحص البصري للنموذج 3D ولدت (انظر طرق أون لاين) أكد وجود المحتملة الزخارف helicase SF2 في KIAA0415 (الشكل S1). واستخدمت الديناميات الجزيئية محاكاة لصقل نموذج KIAA0415 وأيد استقراره وADP من المفترض والمغنيسيوم 2+ الاعتراف (S1 فيديو، طرق أون لاين). هذه النتائج زيادة دعم التنبؤ مجال مثل helicase داخل KIAA0415 والدليل على الحفظ في 3D من بقايا هامة لوظيفتها باعتبارها SF2 helicase المفترضة.

تحميل:
الشكل 3. القائم على بنية تسلسل المحاذاة من المجالات helicase C من SF2 helicases UvrB (2D7D)، Hel308 (2P6R)، RecG (1GM5)، وTRCF (2EYQ).

وتظهر على إجماع عناصر هيكل الثانوي الخوار كما اللوالب الحمراء (α-اللوالب) والسهام الزرقاء (β-فروع). محاذاة تسلسل KIAA0415 تم الحصول عليها من خيوط وتستخدم لبناء نموذج 3D من helicase المفترضة C مثل المجال الخاص به فقا لهذه النماذج الهيكلية هو مبين في الأعلى. يتم تمييز حفظ تسلسل KIAA0415 فيما يتعلق هياكل قالب باللون الرمادي (المحافظ) والأصفر (شبه المحافظ). يتم تمثيل الحذف الفجوة والملاحق من قبل الخطوط المتقطعة ورموز U مقلوب، على التوالي. وصفت الإدراج مع N- المقابلة وC-إنهاء الترقيم بقايا (أسود للKIAA0415 والأخضر لUvrB، والأزرق للHel208). المناطق I، IA، II، III، IV وأكد، وV التوافق الزخارف SF2 helicase. بقايا تشارك في ADP- والمغنيسيوم 2+ ملزمة الملونة باللون الأزرق والأحمر، على التوالي.
دوى: 10.1371 / journal.pbio.1000408.g003

وبناء على هذه النتائج، قررنا زيادة توضيح وظائف الجزيئية الممكنة من KIAA0415. نحن أول اختبار للقوة من KIAA0415 esiRNAs العاملين في مزيد من التفاصيل. كلا esiRNAs المنضب النصوص KIAA0415 مرنا (بكفاءة الشكل 4A) والبروتين (الشكل 4B). نحن ثم كرر فحص DR-GFP في خط الخلية مراسل هيلا ووجدت 3.4 (esiRNA1) و 4.3 (esiRNA2) أضعاف انخفاض في خلايا إيجابية GFP بالمقارنة مع الضوابط، مما يشير إلى انخفاض الترددات إعادة التركيب مثلي (الشكل 4C). درسنا مستويات التعبير عن I-SCEI بعد knockdowns لاستبعاد احتمال أن DSBs لدت I-SCEI-هي خطر (الشكل S2). لاستبعاد احتمال تأثير معين من نوع الخلية، ونحن أيضا اختبار knockdowns في خط خلايا مختلفة. وأظهرت الخلايا U2OS يحمل الموقع الإدراج واحد من بناء DR-GFP انخفاض مماثل للخلايا إيجابية GFP على KIAA0415 ضربة قاضية (الشكل 4D)، مشيرا إلى أن هذا التأثير لم يكن خط خلية معينة. وأخيرا، استبعدنا الممكنة بعيدا عن الهدف الآثار عن طريق أداء عبر الأنواع التجارب رني الانقاذ [43]. التعبير مستقر من الماوس KIAA0415 في DR-GFP خط الخلية البشرية الصادر هذا الخط الخلية مقاومة للesiRNAs الإنسان، توثيق لدور KIAA0415 في HR-DSBR (الشكل 4E). باختصار، تشير هذه النتائج إلى أن KIAA0415 هو رواية المفترض helicase SF2 اللازمة لكفاءة HR-DSBR.

تحميل:
الرقم 4. التحليل الوظيفي للKIAA0415.

(A) كفاءة KIAA0415 مرنا ضربة قاضية مع اثنين من esiRNAs مستقل في خلايا هيلا. وتظهر المستويات النسبية للمرنا 24 ساعة بعد ترنسفكأيشن من esiRNAs المشار إليها. أشرطة الخطأ تشير إلى الانحراف المعياري، ** ع <0.01. (B) كفاءة البروتين KIAA0415 ضربة قاضية مع اثنين من esiRNAs مستقل في خلايا هيلا. KIAA0415-LAP تحليل لطخة غربية من خلايا هيلا مقتطفات يتم عرض 48 ساعة بعد ترنسفكأيشن من أشار esiRNAs. وصمة عار ضد تويولين بمثابة سيطرة التحميل. (C) اثنين esiRNAs KIAA0415 مستقلة تؤثر على وتيرة إصلاح إعادة التركيب مثلي تقاس باستخدام الفحص DR-GFP. النسبة المئوية النسبية للGFP خلايا هيلا إيجابية، تطبيع للخلايا Rluc transfected، يظهر لesiRNAs المشار إليها. أشرطة الخطأ تشير إلى الانحراف المعياري. ** ف <0.01. (D) والنمط الظاهري ضربة قاضية KIAA0415 ليس خط الخلية التابعة. النسبة المئوية النسبية للGFP الخلايا U2OS إيجابية، تطبيع للخلايا Rluc transfected، يظهر لesiRNAs المشار إليها. أشرطة الخطأ تشير إلى الانحراف المعياري، ** ع <0.01. (E) التعبير عن orthologue الماوس KIAA0415 ينقذ النمط الظاهري KIAA0415 رني. وتظهر النسبة المئوية النسبية للGFP إيجابية في الخلايا DR-GFP هيلا التعبير عن ثابت وKIAA0415 الفار من BAC مع transfected esiRNAs المشار إليه. أشرطة الخطأ تشير إلى الانحراف المعياري، ** ع <0.01. تم العثور على (F) إيسفورمس KIAA0415 مختلفة في النواة والسيتوبلازم. ويرد صمة عار KIAA0415 الغربية مقتطفات الخلية هيلا بعد تجزئة الخلية. خدم البقع ضد تويولين وهيستون H3 والضوابط.
دوى: 10.1371 / journal.pbio.1000408.g004
KIAA0415 أشكال معقدة مع البروتينات المصاحبة للشلل سفلي تشنجي

لمزيد من تميز KIAA0415، ونحن الموسومة الجينات على الكروموسوم الاصطناعي البكتيري (BAC) تطبيق نهج TransgeneOmics [44]. هذا الأسلوب يسمح التعبير عن البروتينات الموسومة من المروج لها الأصلي في سياقها الجيني، وبالتالي، يتم التعبير عن هذا البروتين قرب المستويات الفسيولوجية [44]، [45]. تم استنساخ بنجاح C- وN-عضال الموسومة KIAA0415 وأعرب في خلايا هيلا. أظهر البروتين الانصهار تفريق، حشوية، وتوطين النووية، التي لم تتغير كثيرا على تحريض الحمض النووي من التلف (بيانات غير منشورة). Immunoblotting مقتطفات خلية كشف شريطين البروتين الكبرى، وربما يعكس اثنين إيسفورمس KIAA0415 (الشكل 4B). وأظهرت fractionations الخلية التي الإسوي أقصر كان في الغالب النووي، في حين تم العثور على شكل أطول معظمها في السيتوبلازم (الشكل 4F). تجارب مناعي تليها تحديد الطيفي للبروتينات معزولة شارك كشفت تفاعلات KIAA0415-LAP مع SPG11، SPG15، C20orf29، وDKFZp761E198 (الشكل 5A، B والجدول S3). من أجل التحقق من صحة هذه التفاعلات ولدت لنا خطوط الخلايا معربا عن C-عضال SPG11 معلم، SPG15، وDKFZp761E198 مرة أخرى باستخدام نهج TransgeneOmics. تجارب مناعي متبادلة تليها مطياف الكتلة تحليلات في جل ويساعد على هضم أكدت في حل وجود بروتين معقد، والذي يتألف من خمسة أشخاص على الأقل البروتينات الأساسية: KIAA0415، SPG11، SPG15، C20orf29، وDKFZp761E198 (الشكل 5B والجدول S3 ). من أجل اختبار ما إذا كان شركاء التفاعل البروتين من KIAA0415 من شأنه أن يؤثر أيضا HR-DSBR، اختبرنا esiRNAs تستهدف هذه الجينات في مقايسة DR-GFP. ومن المثير للاهتمام، لوحظ انخفاض كبير في خلايا إيجابية GFP على إسكات من C20orf29 وSPG15 مع اثنين من esiRNAs المستقلة (الشكل 6)، مما يشير إلى أن هناك حاجة أيضا هذه البروتينات لكفاءة HR-DSBR. ضربة قاضية من SPG11 وDKFZp761E198، ومع ذلك، لم لا يكون لها تأثير على النسبة المئوية للخلايا إيجابية GFP. معا، وهذه التجارب تكشف عن وجود بروتين معقد الرواية، والتي على الأقل في جزء مطلوب لكفاءة HR-DSBR.

تحميل:
الرقم 5. يتفاعل مع KIAA0415 SPG11، SPG15، DKFZp761E198 وC20orf29.

المواد الهلامية (A) SDS-PAGE تم الحصول عليها من مناعي من KIAA0415-LAP وSPG11-LAP. وقد تم تحديد الطعم (ملحوظ في الخضراء) والفريسة (باللون الأسود) عن طريق الهضم في جل وتحليل nanoLC-MS / MS (انظر الشكل S3). العصابات التي لم يتم وضع علامة تمثل البروتينات الخلفية غير محددة أو بروتينات معينة الطعم (انظر الجدول S3، وطرق أون لاين). (ب) تكوين KIAA0415 بروتين معقد تحليلها على النحو الذي حددته بندقية-LC-MS / MS (انظر الجدول S3). يظهر عدد من يقابل الببتيدات الكشف عن وتغطية تسلسل البروتين. يتم وضع علامة على النتائج للبروتينات الطعم في جريئة.
دوى: 10.1371 / journal.pbio.1000408.g005


تحميل:
يطلب الرقم 6. interactors KIAA0415 لكفاءة HR-DSBR.

النسبة المئوية النسبية للGFP خلايا هيلا إيجابية، تطبيع للخلايا Rluc transfected، يظهر لesiRNAs المشار إليها. أشرطة الخطأ تشير إلى الانحراف المعياري، * p <0.05، ** p <0.01.
دوى: 10.1371 / journal.pbio.1000408.g006
KIAA0415 يتحور في المرضى الذين يعانون من الشلل النصفي التشنجي

وSPG11 شركاء التفاعل KIAA0415 وSPG15، المعروف أيضا باسم spatacsin وspastizin، يتم ترميز من قبل اثنين من الجينات التي ارتبطت مع الشلل النصفي التشنجي وراثي مع رقيقة الجسم الثفني (HSP-TCC) [46]، [47]. HSP-TCC هي مجموعة فرعية من وراثي الشلل النصفي التشنجي (HSP)، التي ورثتها الاضطرابات العصبية الناجمة عن انحطاط مساحات-القشرة في العمود الفقري مما يؤدي إلى الطرف السفلي التشنج. HSP هو شرط غير متجانسة إلى حد كبير مع ما لا يقل عن 46 مواضع تم تحديدها حتى الآن [48]. وقد اقترح التفاعل المحتمل للSPG11 وSPG15 على أساس أعراض عصبية مماثلة [49]، ولكن التفاعل المادي للSPG11 ولم يتم الإبلاغ عن SPG15 حتى الآن. بسبب التفاعل المادي للKIAA0415 مع هذه البروتينات اثنين المشفرة بواسطة الجينات المرتبطة HSP، قررنا أن التحقيق إذا يمكن ربط أي حالات HSP غير المبررة إلى حدوث طفرات في KIAA0415. التسلسل المباشر لKIAA0415 في 166 مريضا HSP لا علاقة لها، بما في ذلك 38 و 64 حالة مع نمط الوراثة المتنحية أو المهيمن و 64 حالات متفرقة (انظر طرق أون لاين)، حدد 7 معروفة و15 متغيرات جديدة، على التوالي. لم تعتبر معظم هذه المتغيرات المسبب للمرض، لأنها لم تؤثر على تسلسل البروتين، لم يتوقع أن تغيير الربط الصحيح، أو عثر عليها أيضا في كثير من الأحيان في عينات التحكم (الجدول S4). ومع ذلك، واحدة من هذه المتغيرات المحددة أدى إلى كودون وقف سابق لأوانه في موقف 527 (c.1413_1426del14 / p.L471LfsX56، الجدول S4) وكان غائبا في 158 القوقاز و84 الكروموسومات السيطرة شمال أفريقيا. وكانت الطفرة متخالف وجدت أية طفرة أو البديل أخرى في تسلسل ترميز KIAA0415 أو في المناطق التنظيمية في هذا المريض يبدو متقطعا (FSP-70-1). لم تكن هناك موضوعات أخرى من عائلة المتاحة لأخذ العينات وتم الكشف عن أية نسخة الاختلافات على الصبغي رقم 7 في المريض المصاب (بيانات غير منشورة)، ولكن إعادة ترتيب متخالف صغيرة أو طفرات في المناطق المكشوفة (الإكسونات غير معروفة أو إنترونات) قد نجا الكشف.
أكثر من المثير للاهتمام، وجدنا أيضا طفرة متماثل في شقيقان الفرنسية (FSP-083)، والذي لم يتم الكشف في 156 قوقازي و 242 الكروموسومات السيطرة شمال أفريقيا. في هؤلاء المرضى، وINDEL معقدة في اكسون 2 (ج [80_83del4؛ 79_84ins22].، الشكل 7C) يولد انزياح الإطار ووقف كودون التالية الأحماض الأمينية 29 (p.R27LfsX3، الشكل 7A). ومن المثير للاهتمام، والإدراج هو أربعة أمثال ناقص من CTGTAA تسلسل (A)، مما يدل على الحمض النووي بوليميريز انزلاق خلال توليف الحمض النووي باعتباره آلية لإدخال الطفرة. كل من المرضى المصابين قدم مع الشلل النصفي التشنجي التدريجي المرتبطة سلس البول منذ سن 50 و 49 على التوالي. كان الشلل MRI طبيعي ولكن لوحظت hyperintensities الشوكي في C3-C4 وC7 في واحدة. توفي كلا الوالدين في سن 72 و 77 على التوالي، لأسباب غير عصبية. أنها نشأت من قريتين المجاورة، ولكن لم يكن هناك زواج الأقارب المعروفة. ومع ذلك، أكد تحليل ثلاث علامات ثيقة الصغرية (D7S531، D7S517، وD7S1492) وفقدان تغاير (LOH) البحث باستخدام CYTO_12 المجهرية (بيانات غير منشورة) أن المنطقة متماثل في كل من المرضى المتضررين (7B الشكل).

تحميل:
الرقم 7. طفرة KIAA0415 في المرضى الذين يعانون HSP.

(A) تمثيل تخطيطي للهيكل KIAA0415 اكسون. وأشار موقع طفرة متماثل وأضعاف helicase المفترضة توقع (باللون الأخضر). (B) النسب من KIAA0415 طفرة في الأسرة FSP-083. تمثل رموز مربع الرجال. تمثل الدوائر النساء. وعبرت رموز المواد الميتة. رموز شغل تشير إلى الأفراد المتضررين. الأرقام أدناه الأفراد هي المرجعية الداخلية لكل فرد العينة. نجوم تشير موضوعات عينات. ويبين الفصل بين الطفرة و3 الصغرية علامات على الصبغي 7P المقبل لنسب، نسبة إلى وضعهم في Mbases. ونظرا لالأليلات من المكروية في أزواج قاعدة. M، طفرة. (C) Electropherograms من الطفرات KIAA0415. وأكد الانحراف متواليات من تسلسل بالوزن.
دوى: 10.1371 / journal.pbio.1000408.g007

لمزيد من إثبات دور KIAA0415 في إصلاح الحمض النووي، قارنا حساسية العقاقير في خطوط الخلايا lymphoblast أنشئت من المريض يحمل طفرة KIAA0415 (FSP-083-4) والمريض يحمل طفرة في SPG15 (FSP-708-22 [50 ]) للسيطرة على خطوط الخلايا lymphoblast. لافت للنظر، كانت خلايا متحولة KIAA0415 معنويا (P <0.05) أكثر حساسية للعلاجات MMC وبليوميسين بالمقارنة مع أي من خطوط الخلايا التحكم (الشكل 8). بالإضافة إلى ذلك، كما أظهرت خط الخلية SPG15 حساسية خفيفة لهذه الأدوية، phenocopying النتائج الملاحظة في خلايا هيلا وU2OS.

تحميل:
الرقم 8. الحساسية من خطوط الخلايا lymphoblast لعوامل ضارة DNA.

(A) منحنيات النمو لسيطرة خلية lymphoblast خط MHU-2619 (خط الصلبة)، خط خلية تحمل KIAA0415 طفرة FSP-083-4 (الخط المنقط) من دون علاج المخدرات (خط أسود) أو العلاج MMC (رمادي فاتح )، يتم عرض. (B و C) خطوط الخلايا المشتقة من المرضى الذين يعانون من طفرة في KIAA0415 وSPG15 هي أكثر حساسية لDNA إتلاف المخدرات. ويظهر انخفاض خلايا قابلة للحياة (يوديد propidium وAnnexin V السلبي) في المئة (شريط رمادي) للخطوط الخلايا المشار إليها بعد العلاج MMC (B) والعلاج بليوميسين (C). * P <0.05.
دوى: 10.1371 / journal.pbio.1000408.g008

مجتمعة، هذه التجارب التعرف KIAA0415 باسم الجينات الرواية، والذي تحور في المرضى الذين يعانون من HSP، وتوريط وجود صلة بين HSP وإصلاح الحمض النووي.

نقاش

باستخدام مكتبة esiRNA جيدا اتسم [16] أجرينا شاشة رني الجينوم على نطاق وحددت 61 الجينات التي بتكاثر انخفاض أو زيادة وتيرة إصلاح الحمض النووي في مقايسة لإعادة التركيب مثلي [17]. فحوصات ثانوية للعمليات ذات الصلة لإصلاح الحمض النووي ثم جاءت العديد من النتائج الأولية. ومن هنا، ونحن نقدم مجموعة البيانات التي يجب الإسراع في اكتشاف جينات جديدة مع أدوار في إصلاح الحمض النووي والظروف الطبية المرتبطة بها. وقد وصفت ثمانية عشر من 61 الجينات المرشحة في غيرها من الدراسات إصلاح الحمض النووي الثدييات على نطاق واسع [8]، [13]، [15]، [51]، مما يدل على فعالية الشاشة لدينا، ولكن تسليط الضوء أيضا أن استخدام مختلفة يمكن فحوصات كشف اللاعبين الرواية. وبالتالي، فإننا نتوقع أن تطوير DNA البديل المقايسات لتصليح شاشات رني سوف تكشف عن جينات إضافية المتورطين في إصلاح الحمض النووي. لدينا شاشة شاركنا في transfected في "DNA كاشف مدمرا،" I-SCEI، جنبا إلى جنب مع مشغلات إسكات esiRNA. وبالتالي، قد يكون غاب عن البروتينات مع نصف حياة طويلة في هذه الشاشة. المقايسات التي يتم فيها عرض DSB بعد مرور بعض الوقت و transfected الخلايا مع مشغلات إسكات يمكنها الكشف عن جينات إضافية تلعب دورا خلال إصلاح الحمض النووي.
على إعطاء الأولوية لتحقيق الجزيئي للبروتينات uncharacterized المحددة في الشاشة، قمنا بتوظيف النهج المعلوماتية الحيوية الهيكلي. استنادا إلى التنبؤ بأن KIAA0415 يمثل helicase المفترضة رواية نحن التحقيق هذا الجين في مزيد من التفاصيل. وضع علامات على الجينات باستخدام نهج TransgeneOmics كشف توطين النووية وكذلك حشوية والتفاعل الجسدي مع أربعة على الأقل البروتينات. وأظهرت التحقيقات الشركاء التفاعل مطلوبة أيضا اثنين على الأقل من هذه البروتينات لكفاءة HR-DSBR. ربما، هذه البروتينات تشكل مجمعا ما هو مطلوب لكفاءة HR-DSBR. وبالتالي، فإن مجمع تفقد نشاطها عند واحد من البروتينات ثلاثة المنضب.
اثنين من شركاء تفاعل KIAA0415 يتم ترميز الجينات التي ترتبط مع الشلل النصفي التشنجي. هذه النتيجة دفعت بنا إلى دراسة ما إذا كانت الطفرات KIAA0415 يمكن أن يفسر التشنج في عينات من المرضى لا ترتبط مع الطفرات في أي من الجينات الشلل النصفي التشنجي المعروفة. نفيدكم طفرة متماثل في KIAA0415، مسؤولة عن الشلل النصفي التشنجي لوحظ في شقيقان. وبالتالي، فإننا تحديد KIAA0415 باعتباره الشلل النصفي التشنجي الجينات رواية المرتبطة بها. وبناء على هذه الحقائق، فإننا نقترح إعادة تسمية KIAA0415 إلى SPG48 وفقا لتسمية HUGO. حقيقة أن ثلاثة البروتينات التي تشكل نتيجة معقدة البروتين في عواقب المظهري مماثلة تقول أن المجمع كله تبذل وظيفة هامة، وهي بالانزعاج عند واحد من البروتينات مفقود أو غير وظيفية. ولذلك سيكون من المثير للاهتمام أن التحقيق ما تبقى من شركاء التفاعل، C20orf29 وDKFZp761E198، للطفرات محتملة في المرضى الذين يعانون HSP، على الرغم من أنها لا تعين معروف HSP مواضع [49]. على الرغم من أن فقط أظهرت حالة واحدة، وكانت خطوط الخلايا المشتقة من المريض يحمل طفرة SPG48 أكثر حساسية للDNA تضر المخدرات من الخلايا السيطرة، مؤيدة لدور SPG48 في إصلاح الحمض النووي. للأسف، كانت المواد من المرضى الآخرين مع الطفرات SPG48 غير متوفرة. ومع ذلك، فإننا نقترح أن في المرضى HSP في المستقبل سيتم عرضها للطفرات في SPG48 وأن يتم فحص الخلايا من هؤلاء الأفراد لإصلاح العيوب DNA.
وقد ارتبطت الجينات الطافرة في HSP مع العديد من الوظائف البيولوجية، بما في ذلك النقل داخل الخلايا، الاستطلاعية محور عصبي، وظائف الميتوكوندريا، استقلاب الكوليسترول، وتشكيل المايلين / الاستقرار، والنشاط chaperonin [48]. وبناء على النتائج التي توصلنا إليها، نقترح أن HSP قد يكون أيضا نتيجة لإصلاح الحمض النووي ضعف، مضيفا HSP إلى قائمة متزايدة من الأمراض العصبية الناجمة عن القصور إصلاح الحمض النووي [4]، [5]، [7]، [8]. في اتفاق مع هذه الفرضية، وقد تم مؤخرا ذكرت SPG11 أن فسفرته على الحمض النووي من التلف عن طريق الصراف الآلي أو ATR [51]. سواء SPG48 (والبروتينات المرتبطة بها) هو عنصر المباشر لمسار HR-DSBR أو بصورة غير مباشرة مرتبطة إصلاح الحمض النووي يبقى أن المنشأة. يظهر تحليل الكيمياء الحيوية في المجال helicase المفترضة من SPG48 أن تكون نقطة دخول جذابة إلى اكتساب رؤى الآلية في وظيفة إصلاح الحمض النووي (ق) من SPG48.
وقد زاد التقدم التكنولوجي في رني فحص السرعة التي بيانات المظهري يمكن الحصول عليها. ومع ذلك، وتفسير ينجم عن ذلك من علاقات التركيب الوراثي، النمط الظاهري لا يزال تحديا، والنهج التي تساعد على فك مطلوبة بكثرة البيانات الفرز. النهج التي تحليل البيانات المظهرية من شاشات رني لا علاقة لها والتي تجمع بين phenotypic- مع البيانات localization- والبروتين [52]، [53] وقد استخدمت بنجاح لألبس الحذاء تحليلات وظيفة النمط الظاهري ل. هنا، نحن استكشاف إمكانية الجمع بين بيانات فحص رني مع النهج المعلوماتية الحيوية الهيكلية. وتوضح النتائج أن هذا المزيج يولد معلومات قيمة، مما يساعد على إعطاء الأولوية لدراسات المتابعة من الجينات المرشحة uncharacterized. ونحن نتصور أن تصميم خط أنابيب التلقائي لتحليل السمات الهيكلية والوظيفية المحتملة وراء التشابه تسلسل البروتين وزيادة تسريع توصيف الجينات التي تم تحديدها في شاشات رني. في المستقبل، سيكون من المهم للجمع بين مختلف "OMICS" والمعلوماتية الحيوية النهج لفهم إصلاح الحمض النووي على مستوى النظم ومواصلة تسريع اكتشاف الجينات ذات الصلة لعلم الأمراض البشرية.

المواد والأساليب

جيل من هيلا DR-GFP خطوط الخليوي

عشرة ميكروغرام من DR-GFP بناء [17] و transfected إلى 2.5 × 10 6 خلايا هيلا باستخدام 12 ميكرولتر محسن (QIAGEN) و 14 ميكرولتر Effectene (QIAGEN) وفقا لبروتوكول الشركة المصنعة. وقد تم اختيار خطوط الخلايا مستقرة مع 3 ميكروغرام / مل بوروميسين (سيغما الدريتش) واستنساخ واحدة تم الحصول عليها عن طريق FACS الفرز على FACSAria (BD العلوم البيولوجية). تم توسيع المستعمرات المستمدة من الحيوانات المستنسخة الفردية واختبار لسلوكهم بعد ترنسفكأيشن مع البلازميد ترميز نوكلياز داخلية I-SCEI. وقد تم اختيار خط الخلية مع الخلايا إيجابية GFP عمليا أي قبل العلاج I-SCEI وعدد كبير من الخلايا إيجابية GFP بعد العلاج I-SCEI للعرض على الشاشة.
التحليل المناعي المجهري

وقد نمت الخلايا على coverslips الزجاج وثابتة مع 3٪ امتصاص العرق (PFA) كما هو موضح سابقا [44]. أجريت stainings المناعي مع الماوس الرئيسي لمكافحة GFP الأضداد (روش تشخيص، 1:4،000 تمييع) وحمار الثانوي الأضداد المضادة للماوس مترافق إلى Alexa488 (المسابر الجزيئية، 1:500 تمييع). كان counterstained الجينوم الحمض النووي مع إطالة الذهب antifade كاشف تحتوي على دابي (إينفيتروجن). تم الحصول على الصور على Axioplan II مجهر (زايس) تعمل من خلال MetaMorph (الأجهزة الجزيئية).
الغربية تحليل وصمة عار

تم إجراء تحليل لطخة غربية كما هو موضح سابقا [52]. في هذه الدراسة تم استخدام الأجسام المضادة الأولية التالية: الماوس مكافحة GFP (روش تشخيص، 1:4،000 تمييع)، والماوس مكافحة DM1alpha تويولين (MPI-CBG جسم مرفق، 1:50،000 تمييع)، والأرنب مكافحة هيستون H3 (Abcam 1:25،000 تمييع).
الجينوم على نطاق esiRNA الشاشة

وقد وصفت المكتبة esiRNA يعملون في أماكن أخرى [16]، [54].لشاشة I-SCEI التعبير البلازميد [17] وشارك في مع transfected esiRNAs الفردية بطريقة العريض. لفترة وجيزة، كان pipetted 50 نانوغرام لكل esiRNA في 5 ميكرولتر TE العازلة إلى 384 جيدا لوحات زراعة الأنسجة (BD العلوم البيولوجية) وتخزينها في -20 ° C. تحتوي كل لوحة أربعة esiRNAs ضد Rad51 عن السيطرة الايجابية (في المواقف C3، C21، M5، M18) و 12 esiRNAs استهداف renilla luciferase المراسل (Rluc) كما المراقبة السلبية (في المواقف C4، D3، D4، C22، D21، D22، M6، N5، N6، M19، N18، N19 كما هو مبين في الشكل 1C). تم الاستغناء عن استخدام موزع متعددة جيدا (WellMate، الحرارية العلمية) خليط من البلازميد I-SCEI (12.75 نانوغرام / جيد) ومحسن (0.142 ميكرولتر / جيد) في 5 ميكرولتر / جيد EC العازلة (QIAGEN) ونسج لفترة وجيزة في هيراوس Multifuge 4KR (الحرارية الكترون شركة). بعد مرور فترة الحضانة لمدة 5 دقائق، Effectene (0.12 ميكرولتر / جيد) مخففة في 5 ميكرولتر / جيد وأضيف EC العازلة إلى كل بئر وتم نسج لوحات لفترة وجيزة مرة أخرى. وقد حضنت الخليط ترنسفكأيشن لمدة 5 دقائق للسماح تشكيل تعقيدا. في هذه الأثناء كانت تحصد خلايا هيلا تحمل مراسل بناء DR-GFP، عدها، والمخففة لتركيز النهائي من 40 خلية / ميكرولتر في DMEM (إينفيتروجن) التي تحتوي على 12.5٪ الجنين مصل بقري (إينفيتروجن). وأضاف خمسين ميكرولتر من خلية إلى تعليق كل بئر باستخدام موزع متعددة جيدا (Wellmate، الحرارية العلمية). من أجل منع التبخر، ومختومة لوحات مع لوحة ختم رقائق تنفس (كورنينج) والمحتضنة في حاضنة زراعة الأنسجة عند 37 درجة مئوية في 5٪ CO 2. تم استبدال المتوسطة 24 ساعة بعد ترنسفكأيشن. بعد غسلها 72 خلايا ساعة أخرى مع برنامج تلفزيوني وفصل بإضافة 15 ميكرولتر / جيد التربسين / EDTA (إينفيتروجن). بعد تم إصلاح 25 دقيقة الخلايا بإضافة 15 ميكرولتر / جيد 3٪ PFA وتخزينها لا تزيد عن 48 ساعة عند 4 درجات مئوية. ويعاير الخلايا مع FACSCalibur (BD العلوم البيولوجية) مجهزة الإنتاجية عينات العليا (BD العلوم البيولوجية). تم الحصول على البيانات وتحليلها باستخدام CellQuest برو (BD العلوم البيولوجية).
تقييم ضرب

حسبت Z-درجات النسب المئوية للخلايا إيجابية GFP باستخدام المعادلة التالية: Z = (س-μ) σ -1 مع: س - النسبة المئوية للخلايا إيجابية GFP. μ - يعني النسبة المئوية للخلايا إيجابية GFP. σ - الانحراف المعياري من عدد الخلايا إيجابية GFP. في الشاشة الرئيسية يعني وحسبت الانحرافات المعيارية بشكل منفصل لكل لوحة على جميع العينات على لوحة باستثناء الضوابط. تم حساب Z-علامات لكل esiRNA وبلغ متوسط ​​التكرارات. تم استخدام ترنسفكأيشن من esiRNA استهداف Rad51 عن السيطرة الإيجابية وكمرجع لأداء الاختبار. التي كانت esiRNAs متوسط ​​الدرجة المعيارية أدناه -2 أو أكثر من 2 كانت تعتبر الزيارات الأولية (الجدول S1).
في مزيد من التجارب التحقق من صحة، وحسبت ض عشرات على أساس المتوسط ​​والانحراف المعياري للسيطرة سلبية (Rluc ترنسفكأيشن). التي كانت EsiRNAs متوسط ​​الدرجة المعيارية لمدة 4 مكررات أدناه -2 أو أكثر من 2 لأحد esiRNA وتحت -1.5 أو أكثر من 1.5 لesiRNA الثانية تم تصنيفها على أنها يضرب التحقق من صحتها. يتم عرض تسلسل التمهيدي لesiRNAs المستخدمة في الجدول S5.
تم إجراء التحليل الجيني تخصيب باستخدام أدوات التحليل النمر (http://www.pantherdb.org/tools/).
سيسبلاتين / MMC / IR حساسية الفحص

كان pipetted خمسة عشر نانوغرام لكل esiRNA مخففة في 5 ميكرولتر غروب MEM (إينفيتروجن) في 384 جيدا لوحات زراعة الأنسجة (غرينر). تم تخفيفه Oligofectamine 0.2 ميكرولتر (إينفيتروجن) مع 4.8 ميكرولتر غروب MEM، المحتضنة لمدة 5 دقائق وpipetted إلى كل بئر من لوحة. حضنت خلطات لمدة 20 دقيقة للسماح أضيفت تشكيل معقد و 1،000 خلايا في 40 ميكرولتر المتوسطة إلى كل بئر. أربع وعشرين ساعة بعد ترنسفكأيشن سيسبلاتين (100 نانوغرام / مل) أو MMC (100 نانوغرام / مل) وأضيفت لمدة 1 ساعة أو تعرض الخلايا إلى 10 غراي IR. تم غسلها خلايا بعناية مع برنامج تلفزيوني وأضيف الوسيلة الجديدة. بعد الخلايا كانت ثابتة إضافية 48 ساعة مع -20 ° C الميثانول البارد لمدة 20 دقيقة، وغسلها مرتين مع برنامج تلفزيوني، وسدت مع عازلة تمنع (0.2٪ الجيلاتين من الماء البارد جلد السمك (سيغما الدريخ كيمي) في PBS) لمدة 5 دقائق. كانت ملطخة نواة الخلية مع دابي (1 ميكروغرام / مل)، وحفظت الخلايا مع 0.02٪ أزيد الصوديوم في برنامج تلفزيوني. تم الحصول على الصور على مجهر أوليمبوس IX81 (أوليمبوس) وتم تحديد أعداد الخلايا باستخدام برنامج التحليل Scan∧R (أوليمبوس). وتكررت كل ضربة قاضية 3 مرات. وتمت مقارنة أعداد الخلايا مع وبدون وكلاء ضررا DNA لtransfections Rluc.
GammaH2AX الفحص

تم علاج خلايا هيلا مع 10 غراي IR 48 ساعة بعد esiRNA ترنسفكأيشن والثابتة 1 ساعة أو 6 ساعات في وقت لاحق. كانت ملطخة الخلايا مع الأجسام المضادة الفوسفات-H2AX (استنساخ JBW301، شمالي ولاية التكنولوجيا الحيوية، 1:600 ​​تمييع) ومع حمار لمكافحة فأر TxRed الضد مترافق (المسابر الجزيئية، 1:400 تمييع). كانت ملطخة الحمض النووي مع دابي (1 ميكروغرام / مل). حفظت الخلايا مع 0.02٪ أزيد الصوديوم في برنامج تلفزيوني والصور تم الحصول على مجهر أوليمبوس IX81 وتحليلها بواسطة تحليل Scan∧R البرمجيات (أوليمبوس). وتكررت كل ضربة قاضية 3 مرات. وتمت مقارنة النسب المئوية للخلايا إيجابية gammaH2AX إلى transfections Rluc. ص حسبت القيم التي كتبها الطالب ر الاختبار.
الهيكلية المعلوماتية الحيوية طرق

فشل التحليل القائم على التسلسل (انفجار) لتحديد أي تناظر تسلسل ذات دلالة إحصائية بين KIAA0415 وأي بروتين يتميز سابقا. طبقت أضعاف تقنيات الاعتراف للبحث عن homologies الهيكلية المحتملة للKIAA0415 مع هياكل البروتين المعروفة. تم استخدام خوارزمية خيوط ProHit (ProCeryon العلوم البيولوجية) للبحث عن التشابه الهيكلي للتسلسل KIAA0415 uncharacterized مع هياكل البروتين من بروتين بروكهافن بنك المعلومات (PDB). وقد أجريت الحسابات خيوط مع المعلمات وظائف التهديف كما نشرت سابقا [55]. تم استخدام مكتبة أضعاف تتكون من 19.961 سلاسل البروتين يمثل PDB في هوية تسلسل 95٪. تم إنشاؤها ثلاثي الأبعاد (3D) نماذج لKIAA0415 بواسطة خيوط تسلسل من خلال كل حظيرة المكتبة أضعاف. التفتيش على تغطية أضعاف، موقف الثغرات والمحتوى في التحالفات تسلسل إلى بنية الحصول عليها، جنبا إلى جنب مع تحليل بنية التنبؤ الثانوية التي تم الحصول عليها عن طريق KIAA0415 PredictProtein (http://www.predictprotein.org/ استخدمت) لتجاهل ممكن ايجابيات كاذبة في أعلى طيات التهديف. تم بناء نموذج ثلاثي الأبعاد للKIAA0415 على أساس التحالفات الترابط التي تم الحصول عليها بثقة عالية توقع طيات وأربعة مبان قالب (PDBId: 2d7d، 2p6r، 1gm5، و2eyq) باستخدام صانع التماثيل في ستوديو ديسكفري (Accelrys V1.7). الالتحام اليدوي للADP والمغنيسيوم 2+ تم على الناتج نموذج KIAA0415 3D على أساس الهياكل الأشعة السينية 2d7d و1gm5. وقد تم صقل مجمع تم الحصول عليها مع AMBER 10 [56]. وأعقب الخطوة الأولى من الطاقة التقليل من قبل 1000 دورات أشد النسب و 500 دورات المترافقة مع التدرج القيود قوة التوافقي على ذرات البروتين 3000 دورات من أصل أشد ودورات 3000 من المكورات التدرج دون قيود. ثم يسخن النظام من 0 إلى 300K لمدة 10 ملاحظة. وأعقب خطوة موازنة من 30 ملاحظة في 300K قبل 10 نانوثانية MD المدى الإنتاجي. مجال القوة ff03، استخدمت شروط الحدود دورية في الضغط المستمر مع انجيفين درجة الحرارة اقتران وBerendsen ضغط اقتران، TIP3P المذيبات صريح، counterions، 8 Å قطع للتفاعلات غير المقيد، والخوارزمية هزة للهيدروجين.
BAC Transgeneomics

تم تنفيذ BAC recombineering وتوليد خطوط الخلايا BAC المعدلة وراثيا كما هو موضح سابقا [44]، [57]. يتم تقديم قائمة بجميع البكالوريا والاشعال المستخدمة في هذه الدراسة في الجدول S6.
مناعي وتحليل الطيف الكتلي

وتم استخدام الأجسام المضادة الماعز المضادة للGFP (MPI-CBG جسم مرفق) ثبتوا على بروتين G-sepharose و (GE للرعاية الصحية) أو GFP-فخ (Chromotek) للمناعي [44]، [52]. الجلايسين eluated KIAA0415-LAP وSPG11-LAP المجمعات تم تحليلها على الفضة ملطخة SDS PAGE. وقد شرائح رفعه هضمها في جل وتحليلها بواسطة nanoLC-MS / MS على LTQ (الحرارية فيشر العلمية) كما ذكرت سابقا [58]، [59]. واستخدمت eluates الجلايسين من KIAA0415-LAP، KIAA0415-NFLAP، SPG11-LAP، وimmunopurifications DKFZp761E198-LAP للهضم في حل وتحليلها بواسطة بندقية-LC-MS / MS على LTQ Orbitrap (الحرارية فيشر العلمية) [60]. واعتبرت البروتينات التي تم تحديدها في أكثر من 15٪ من 193 immunoprecipitations مستقلة أجريت في مشاريع التعاون الجارية من الطعوم لا علاقة لها خلفيات المشتركة ومواصلة استبعاد.
تجزئة الخلية

تم تنفيذ تجزئة الخلية مع ProteoExtract عدة المتاحة تجاريا (Novagene، ميرك العلوم البيولوجية) وفقا لبروتوكول الشركة المصنعة.
المرضى المواد

اخترنا 166 حالة المؤشر غير ذات صلة مع الشلل النصفي التشنجي تشخيص وفقا لمعايير هاردينغ [61]. كان 109 شكل نقي من المرض، وكان 57 شكل معقدة متداخلة جزئيا مع النمط الظاهري نموذجي SPG11. وكان من بينهم 64 مريضا مؤشر من الأسر التي لديها الميراث المهيمن (متوسط ​​العمر عند بداية: 27.0 ± 16.6 ص)، 38 مريضا مؤشر والميراث متوافق مع مقهورة (متوسط ​​العمر عند بداية: 25.6 ± 19.9 ص)، و 64 مريضا مع عدم وجود تاريخ عائلي للمرض (متوسط ​​العمر عند بداية: 31.2 ± 16.9 ص). كان معظم المرضى الفرنسية = 137)، في حين نشأت بقية المرضى من بلدان أخرى في أوروبا = 16)، وشمال أفريقيا = 8)، أو في أي مكان آخر = 5).
وافقت هذه الدراسة من قبل لجنة أخلاقيات المحلية (موافقة رقم 03-12-07 من COMITE الاستشاري لصب لا حماية قصر Personnes ET LA بحوث Biomédicale باريس نيكر إلى الدكاترة A. الدر وA. بريس). أبلغت وتم توقيع موافقات مكتوبة من قبل جميع الأعضاء المشاركين في الأسر قبل جمعت عينات الدم لاستخراج الحمض النووي. أجريت جميع التقييمات السريرية وفقا للبروتوكول التي وضعتها الشبكة الأوروبية والمتوسطية لالإنحطاط مخيخي شوكي (SPATAX، المنسق: الدكتور A. الدر) التي تضمنت: لمحة تاريخية كاملة الطبي والفحص، تقدير العمر عند بداية من قبل المريض، مراقبة علامات اضافية العصبية، electroneuromyographic (ENMG) دراسات، والتصوير بالرنين المغناطيسي الدماغ، عندما يكون ذلك ممكنا. تم تقييم الإعاقة على مقياس 7 نقاط كما هو موضح سابقا [62]، [63].
الطفرات في SPAST، SPG3، SPG6، وSPG42 استبعدت سابقا في معظم المرضى مؤشر لنقل المهيمن التسلسل المباشر وتعدد تعتمد على ربط التحقيق التضخيم في حالة SPAST وSPG3 [64] وبيانات غير منشورة. بين المرضى المتنحية وراثي متفرقة، تم استبعاد طفرات في CYP7B1 / SPG5 الجينات في معظم المرضى [63] في حين تم استبعاد SPG11 وSPG15 الطفرات في جميع أشكال مقهورة معقدة [50].
الكشف عن الطفرات

بكل exons الترميز من KIAA0415 الجين (المورثة Ensembl ID: ENSG00000164917) تم تضخيمها وتقاطعات لصق عن طريق PCR على Thermocycler 9700 (النظم البيولوجية التطبيقية، فوستر سيتي، كاليفورنيا) باستخدام بادئات محددة (انظر الجدول S7). والتسلسل 3.1 كيلو بايت في 3 "و 1.5 كيلو بايت على-UTRs 5'أيضا في المرضى الذين يعانون من انتقال مقهورة يحمل البديل متغايرة واحد. والتسلسل في amplicons في كلا الاتجاهين باستخدام الكيمياء BIGDYE V3 في التسلسل ABI3730 الآلي (النظم البيولوجية التطبيقية) على النحو الموصى به من قبل المورد. تم استخدام V2.6 seqscape (النظم البيولوجية التطبيقية) برنامج لتسليط الضوء على الاختلافات النوكليوتيدات بالمقارنة مع التسلسل الطبيعي للإجماع على حد سواء الجينات. في FSP70 الأسرة، وأكد طفرة بعد subcloning من المنتجات PCR في pcDNA3.1 / V5-صاحب TOPO TA ناقلات باستخدام البكتيريا TOP10 وفقا لتوصيات الشركة الصانعة (إينفيتروجن) والتسلسل المباشر للا يقل عن 5 استنساخ مستقلة لكل من الأليلات.
بعد تحديد البديل، reamplification وresequencing تم إجراء منهجي. تم التحقق من الفصل بين الطفرات / الأشكال مع المرض عن طريق التسلسل المباشر في أفراد الأسرة الإضافية التي كانت متوفرة عينات من الحمض النووي. بالإضافة إلى ذلك، تم عرض 79 و 121 موضوعات القوقاز وشمال أفريقيا صحية لا علاقة لها تقييم وتيرة التغيرات النوكليوتيدات جديدة. من أجل تقدير الحفظ التطوري، تم تحميلها تسلسل الجيني لأنواع مختلفة من متصفح الجينوم Ensembl (www.ensembl.org) والانحياز باستخدام خوارزمية ClustalW (http://www.ebi.ac.uk/Tools/clustalw2/index هتمل). تم اختبار جميع المتغيرات بصورة منهجية من حيث تأثيرها على الربط تم اختبار الآثار المتوقعة للتغيرات مغلطة باستخدام فرزت وPOLYPHEN في http://sift.jcvi.org/www/SIFT_seq_submit2.html وhttp://genetics.bwh.harvard.edu/pph/.
Lymphoblast خطوط الخليوي

وقد تم الحصول على خطوط الخلايا من المرضى عن الإصابة بفيروس ابشتاين بار للفيروسات (الجدول S8). تم مثقف Lymphoblast في RPMI المتوسطة تستكمل مع 1٪ من ركلة جزاء / بكتيريا، 2 مم L-الجلوتامين، 10 ملي HEPES، 1٪ Fungizone، و 20٪ FCS. كانت مطلية 200،000 الخلايا في 6 لوحات جيدا ومثقف بدون أو مع 10 نانوغرام / مل MMC أو تعريضها إلى 10 ميكروغرام / مل بليوميسين لمدة 1 ساعة. تم رصد نمو الخلايا يوميا عن طريق عد الخلايا السلبية الزرقاء التريبان باستخدام عداد الخلية الكونتيسة الآلي (إينفيتروجن). بعد أربعة أيام الحضانة كانت ملطخة 100،000 الخلايا مع FITC Annexin V Appoptosis كيت II (BD العلوم البيولوجية)، يليه FACS (BD العلوم البيولوجية) التحليلات التالية بروتوكول الشركة المصنعة. وقد أجريت تجارب مرتين في مكررة.

دعم المعلومات

الرقم S1.

نموذج 3D المجال KIAA0415 SF2 (أ) و قطعة RMSD على طول محاكاة MD (ب).
دوى: 10.1371 / journal.pbio.1000408.s001
(3.81 MB EPS)

الرقم S2.

KIAA0415 ضربة قاضية لا تؤثر على مستويات التعبير I-SCEI.
دوى: 10.1371 / journal.pbio.1000408.s002
(0.69 MB EPS)

الرقم S3.

التفاعل البروتينات للبروتين معقد KIAA0415 الأساسية.
دوى: 10.1371 / journal.pbio.1000408.s003
(0.89 MB EPS)

الجدول S1.

بيانات فحص رني الابتدائي. الأحمر، esiRNAs إنخفاضا وتيرة إعادة التركيب مثلي أدناه متوسط ​​ض نتيجة -2. الخضراء، esiRNAs أن زيادة وتيرة إعادة التركيب مثلي فوق متوسط ​​الدرجة المعيارية 2. نا، غير متوفرة.
دوى: 10.1371 / journal.pbio.1000408.s004
(3.90 MB XLS)

الجدول S2.

النتائج خيوط.
دوى: 10.1371 / journal.pbio.1000408.s005
(0.02 MB XLS)

الجدول S3.

البروتينات التي تم تحديدها من قبل nanoLC-MS / MS وبندقية-LC-MS / MS بعد immunoprecipitations. واعتبرت البروتينات يضرب ثقة عندما يتم تحديدها مع ثلاثة على الأقل من الببتيدات مع أيونات التميمة يسجل أكثر من 20.
دوى: 10.1371 / journal.pbio.1000408.s006
(0.06 MB DOC)

الجدول S4.

قائمة المتغيرات والطفرات وجدت في KIAA0415.
دوى: 10.1371 / journal.pbio.1000408.s007
(0.03 MB XLS)

الجدول S5.

تسلسل التمهيدي تستخدم لتوليد esiRNAs الثانوي. AR، راثي مقهور؛ AD، جسمية مهيمنة. مكتب التخطيط الاستراتيجي، وحالات متفرقة. القدرة على الربط ESE، Exonic. غ، لا ينطبق، dbSNP، النووية المنفردة الأشكال قاعدة البيانات في http://www.ncbi.nlm.nih.gov/projects/SNP/.
دوى: 10.1371 / journal.pbio.1000408.s008
(0.04 MB XLS)

الجدول S6.

استنساخ BAC وتسلسل التمهيدي تستخدم لBAC العلامات.
دوى: 10.1371 / journal.pbio.1000408.s009
(0.02 MB XLS)

الجدول S7.

قائمة الاشعال المستخدمة في الكشف عن الطفرات KIAA0415.
دوى: 10.1371 / journal.pbio.1000408.s010
(0.02 MB XLS)

الجدول S8.

خطوط الخلايا Lymphoblast المستخدمة في التجارب حساسية.
دوى: 10.1371 / journal.pbio.1000408.s011
(0.01 MB DOC)

S1 الفيديو.

الديناميات الجزيئية محاكاة لالمفترضة نطاق helicase C في KIAA0415 (انظر طرق الآن). ويرد البروتين في تمثيل الكرتون. وتظهر المناطق helicase عزر SF2 في الألوان: I باللون الأبيض، IA باللون الأصفر، والثاني باللون البرتقالي، والثالث باللون الأحمر، والرابع في السماوي، وV باللون الأزرق. ADP وثلاثة المخلفات (E379، D481، وE652) تنسيق المغنيسيوم 2+ ترد في العصي والملونة عن طريق نوع ذرة. ملغ 2+ يمثله المجال الأخضر.
دوى: 10.1371 / journal.pbio.1000408.s012
(1.56 MB MPG)

 

__________________
استشارى الادوية الطبيعيه وباحث وخبير فى علاجات التوحد
رد مع اقتباس
  #17  
قديم 11-22-2015, 11:31 PM
رافت ابراهيم رافت ابراهيم غير متواجد حالياً
عضو ذهبي
 
تاريخ التسجيل: Dec 2011
المشاركات: 520
افتراضي Nipa1 (spg6)، وأساس وراثي جسمي شكل وراثي مشلول الشلل النصفي، يشفر الناقل وظيفية المغنيسيوم 2+ *

 

http://www.jbc.org/content/282/11/8060.full


ملخص

الطفرات في NIPA1 (SPG6) الجين الذي يحمل اسم "ن على ط mprinted في P ريدر-ويلي / A ngelman" لقد تورطت في شكل واحد من مرض وراثي جسمي الشلل النصفي التشنجي وراثي (HSP)، وهو اضطراب الاعصاب تتميز التدريجي أقل التشنج أطرافهم والضعف. ومع ذلك، فإن وظيفة NIPA1 غير معروف. هنا، وتبين لنا أن انخفاض تركيز المغنيسيوم يعزز التعبير عن NIPA1 مما يشير إلى دور في استقلاب المغنيسيوم الخلوية. في الواقع NIPA1 يتوسط المغنيسيوم 2+ امتصاص هذا هو كهربي، التي تعتمد على التيار الكهربائي، ويمكن إشباعه مع ثابت ميخائيل 0.69 ± 0.21 م م عندما أعرب في البويضات القيطم. أظهر توطين التحت خلوية مع المناعي أن الذاتية الزميلة البروتين NIPA1 مع الإندوسومات المبكرة وسطح الخلية في مجموعة متنوعة من الخلايا العصبية والظهارية. كما هو متوقع من الجين المغنيسيوم استجابة، نجد أن تركيز المغنيسيوم تغير يؤدي إلى إعادة توزيع بين مقصورة endosomal وغشاء البلازما. النتائج المغنيسيوم عالية في تضاءلت NIPA1 سطح الخلية في حين المغنيسيوم المنخفض يؤدي إلى تراكم في الإندوسومات المبكر والتجنيد لغشاء البلازما. وأظهرت المسوخ NIPA1 الماوس، T39R وG100R الموافق المسوخ البشرية منها خسارة-وظيفة عندما أعرب في البويضات وغيرت الاتجار في الخلايا COS7 transfected. نستنتج أن NIPA1 يشفر عادة المغنيسيوم 2+ نقل وفقدان للوظيفة NIPA1 (SPG6) بسبب الاتجار غير طبيعية من البروتين تحور يوفر أساس النمط الظاهري HSP.
القسم السابق القسم التالي
يدعى NIPA1 [NT_078094] الجيني ل "ن ط على mprinted في P-ريدر ويلي / A ngelman" لأنه كان يعتقد أن يكون موجودا بين حوالي 30 جينات مطبوع مرتبطة كروموسوم 15q11-Q13 (SPG6 مكان) تشارك في Prader- متلازمة ويلي (1 - +5). ومع ذلك، NIPA1 كما تورطت في آخر اضطراب واضح راثي يسمى المهيمن الشلل النصفي التشنجي وراثي (HSP) 4 (OMIM 608145 و600363). تضم HSP أكثر من 30 الاضطرابات الوراثية التي هي مشية تشنجي (ميزة السائد 6). وقد ارتبطت طفرات في الجينات لا يقل عن ستة مع راثي HSP المهيمن بما في ذلك NIPA1 (SPG6). تقدم هذه المجموعة غير متجانسة مع التدريجي أقل التشنج أطرافهم والضعف. في غياب المظاهر السريرية الأخرى ويشار إلى هذه الاضطرابات إلى نقية كما أو غير معقدة HSP (6). فينك وآخرون. (7، 8) أن غير معقدة HSP ارتبط كروموسوم 15q، منطقة NIPA1. حددت دراسات إضافية قبل هذه المجموعة إجراء تبديل النوكليوتيدات في موقف 134 من NIPA1 [كدنا أن أدى إلى استبدال الحمض الأميني في موقف 45 من البروتين NIPA1 (T45R) في ربط SPG6 HSP المشابهة وفي علاقة المشابهة التي كانت صغيرة جدا للربط تحليل (9). وفي الآونة الأخيرة، حددت ثلاث مجموعات بحثية مختلفة إجراء تبديل مغلطة في NIPA1، G106R، في عدد من أسر لا علاقة كبيرة (+10 - 12). لم يتم تحديد الدور الوظيفي للNIPA1 في برادر ويلي أو HSP المتلازمات.
المغنيسيوم هو ثاني الموجبة الأكثر وفرة داخل الخلايا ويلعب دورا هاما في العديد من الوظائف الكيميائية الحيوية داخل الخلايا (13). على الرغم من وفرة وأهمية المغنيسيوم، لا يعرف إلا القليل حول كيفية الخلايا حقيقية النواة تنظيم محتوى المغنيسيوم بهم. الخلايا الحرة المغنيسيوم 2+ التركيز هو في حدود 0.5 م م، وهو 1-2٪ من مجموع المغنيسيوم الخلوية (13). وفقا لذلك، يتم الحفاظ على الخلايا المغنيسيوم 2+ دون تركيز توقع من إمكانات الكهروكيميائية عبر الغشاء. وينظم الخلايا المغنيسيوم 2+ تركيز ناعما المحتمل عن طريق فرض ضوابط دقيقة من المغنيسيوم 2+ دخول، والمغنيسيوم 2+ هروب رأس المال، وحجرات تخزين الخلايا (14). لقد أثبتنا أن المغنيسيوم 2+ المدخلة من خلال مسارات محددة وتنظيم المغنيسيوم التي تنظمها آليات الجوهرية بحيث ثقافة الخلايا في وسائل الإعلام التي تحتوي على المغنيسيوم نتائج منخفضة في ما يصل التنظيم من المغنيسيوم 2+ امتصاص داخل الخلايا. وقد أظهرت هذه الزيادة على التكيف في المغنيسيوم 2+ دخول أن تعتمد على دي نوفو النسخ منذ المعالجة المسبقة للخلايا الظهارية مع أكتينوميسين D منعت التكيف مع انخفاض المغنيسيوم خارج الخلية (15). وتشير البيانات إلى أن الخلايا الظهارية يمكن الشعور المغنيسيوم البيئي وخلال عمليات transcription- والتي تعتمد على ترجمة يغير النقل المغنيسيوم 2+ والحفاظ على توازن المغنيسيوم.
في محاولة لتحديد الجينات الكامنة وراء التغيرات الخلوية الناتجة عن التكيف مع المغنيسيوم خارج الخلية المنخفض، استخدمنا تحليل النوكليوتيد ميكروأري للكشف عن النصوص التنظيم المغنيسيوم في الخلايا الظهارية (16). نص واحد، NIPA2، كان إلى حد كبير من قبل المغنيسيوم خارج الخلية مما يدل على أن التوليف ينظمها التغييرات في المغنيسيوم خلية التنظيم الأعلى. 5 أظهرنا أن NIPA2 بوساطة المغنيسيوم 2+ النقل عند المعبر عنها في القيطم المورق البويضات. وبحثا سيليكون وأظهرت العضو الثاني من هذه العائلة من البروتينات، NIPA1. وكان الهدف من هذه الدراسة لمعرفة ما إذا NIPA1 يتوسط النقل المغنيسيوم 2+ باستخدام دراسات الكهربية ومضان. وعلاوة على ذلك، تقرر توزيع الخلوية وتوطين التحت خلوية من خلال تحليل لطخة غربية والمناعي المجهري. تم تقييم إعادة توزيع البروتين NIPA1 في استجابة للتغيرات في المغنيسيوم الخلوية. وأخيرا، فإن NIPA1-T39R وG100R المسوخ، ويرتبط مع HSP، تم إنشاؤها واختبارها. وتشير البيانات المتوفرة لدينا أن بروتين NIPA1 يتوسط النقل المغنيسيوم 2+ وينظمه المغنيسيوم مشيرا إلى أنه قد تلعب دورا في السيطرة على الخلوي توازن المغنيسيوم. أدت الطفرات T39R وG100R في الاتجار داخل الخلايا تغير من البروتين NIPA1 وتضاءلت المغنيسيوم 2+ النقل مما يشير إلى دور في النمط الظاهري HSP.

المواد والأساليب

تم شراؤها بناء التعبير ناقلات ترميز NIPA1 -A الماوس NIPA1 كدنا] استنساخ من بتبريد، رقم الكتالوج B430207K20. والإنسان NIPA1 كدنا] هو أطول من تسلسل الماوس بسبب امتدادا AAAAAA N-المحطة. والتسلسل Subclones لتأكيد سلامة التسلسل. التركيبة الناتجة، pFLCI-mNIPA1، تضمن الترميز المنطقة بأسرها من mNIPA1 كدنا] يحيط بها 20 سنة مضت من غير مترجم تسلسل 5'-النوكليوتيدات و 929 سنة مضت من غير مترجم 3'-التسلسل. اثنين من الماوس بنيات متحولة، pFLCI-mNIPA1-T39R وpFLCI-mNIPA1-G100R، حيث تم استبدال منتدى المجالس الرومانسية 39 (ACG) مع الارجنتين 39 (AGG) والغليسين تم استبدال 100 (GGG) مع الارجنتين 100 (AGG)، على التوالي، كانت تنتج من pFLCI-mNIPA1 باستخدام QuikChange II XL موقع الموجه عدة الطفرات (Stratagene). تم إضافة بصمة HA-C محطة لNIPA1 كدنا] بواسطة PCR مع قليل النوكليوتيد (5N1Sac1: 5'-GGCGGCGAGCTCGGCATGGGGACTG-3 "، 3N1HA: 5'-TTAAGCGTAATCTGGAACATCGTATGGGTAGTCTGTTTTCATATTGG-3 ') التي تحتوي على HA الكامل. وNIPA1-HA ثم subcloned في ناقلات pEGFP-N1 استبدال العلامة EGFP مع HA مما أدى إلى البلازميد HA-N1-NIPA1. كانت خلايا COS7 مثقف على النحو المبين أدناه وعابر. مع HA-N1-NIPA1 باستخدام Lipofectamine 2000 (إينفيتروجن).
التعبير عن ماوس NIPA1 التركيبات في القيطم البويضات وتوصيف المغنيسيوم 2 + النقل، للحصول على القيطم البويضة التعبير، تم تصنيعه كرنا من mNIPA1، mNIPA1-T39R، وmNIPA1-G100R كدنا] يبني، خطي، ومن ثم نسخها مع T7 البلمرة في وجود M7 سقف GpppG باستخدام mMESSAGE ماكينة ™ T7 KIT (AMBION) نظام النسخ. كان إعداد البويضات، وحقن مع كرنا، واثنين من الجهد الكهربائي المشبك كما هو موضح سابقا، وأجرى في 21 ° C (16). تمت دراسة البويضات 3-5 أيام بعد الحقن. تم حساب نسب نفاذية باستخدام العلاقة Nernstian وK م وV ماكس القيم واضحة مع تحليل الانحدار غير الخطية (16).
تم استخدام المجهر epifluorescence لقياس المغنيسيوم 2+ تدفق إلى البويضات واحدة باستخدام المغنيسيوم 2+ -responsive-ماج FURA-2 صبغ مضان (16). تم حقن البويضات مع 50 μ M-ماج FURA-2 حامض (المسابر الجزيئية)، 20 دقيقة قبل التجريب. وقد شنت الغرفة (0.5 مل) على مجهر نيكون Diaphot-TMD مقلوب، مع فلور × 10 هدف، وتحديد جمعية I-V. وفي وقت لاحق، كانت فرضت في -70 بالسيارات لقياسات مضان لالأوقات المحددة. مضان تم تسجيلها بشكل مستمر باستخدام ثنائي الطول الموجي الإثارة الطيفي (دلتا المسح، فوتون تكنولوجيز) مع الإثارة لل-ماج FURA-2 في 340 و 385 نانومتر (سرعة المروحية التي حددت في 100 هرتز) والانبعاثات في 505 نانومتر. يتم عرض النتائج على هيئة نسبة 340/385، الأمر الذي يعكس الخلايا المغنيسيوم 2+ التركيز.
وقد حافظت الفئران إعداد الحيوانية والخلية الثقافة -Male لمدة 5 أيام على اتباع نظام غذائي منخفض المغنيسيوم (ICN النظام الغذائي رقم 902205، الكيميائية الحيوية الغذائية) تستكمل مع 0.05٪ MgSO 4 يمكن مقارنتها مع طعام الماوس التجاري (17).
كانت COS7، والماوس البعيدة نبيب الملتوية (MDCT)، HEK293، والخلايا العصبية الحصين الابتدائية المثقف في الحد الأدنى من المتوسط ​​الضروري أن تستكمل مع 10٪ مصل بقري جنيني، البيروفات الصوديوم (110 ملغ / لتر)، 5 م مل -glutamine و 50 وحدة / مل البنسلين، و 50 ميكروغرام / الستربتومايسين مل في بيئة ترطيب 5٪ CO 2 -95٪ الهواء في 37 ° C. تم عزل الخلايا العصبية الأولية من أدمغة الفئران ومثقف باستخدام أساليب مماثلة لتلك التي سبق وصفها (18). حيث المشار إليها، كانت خلايا subconfluent مثقف في أبعاده المغنيسيوم 2+ خالية، العادي المغنيسيوم 2+، 0،08 م م، أو ارتفاع المغنيسيوم 2+ و 5.0 م م ومتوسطة (تقنيات الخلايا الجذعية) ل3 أو 16 ساعة قبل الحصاد أو تجهيز كيمياء المناعة كما ذكرت سابقا (16). وكانت عناصر أخرى من المغنيسيوم 2+ ثقافة خالية المتوسطة على غرار المتوسطة كاملة.
وتم قياس كمية التحليل الكمي للNIPA1 النصوص التي في الوقت الحقيقي المنتجات عكس النسخ، PCR -PCR مستمر مع AB7000 ™ (النظم البيولوجية التطبيقية) باستخدام SYBR الخضراء ™ مضان وفقا لتعليمات الشركة الصانعة. التمهيدي مجموعة من الماوس NIPA1 كان: 5'-CTGGTGGACTTCTTGGGCAT-3 "(إلى الأمام) و5'-TCCAATGCCTGTTCCTCAA-3" (عكس). وتم تطبيع المبالغ النسبية للNIPA1 RNA إلى النصوص الماوس β-أكتين.
تم تحديد تسلسل الجينوم تحليل تسلسل -THE NIPA1 كدنا] بالطرق العادية. وNIPA1 تسلسل الأحماض الأمينية طول الكامل في قاعدة بيانات بنك الجينات ™ (أرقام الانضمام: NP_653200 (الإنسان) وNP_705806 (الماوس)). وقد تم تحديد الدوافع البروتين باستخدام BLASTP وقاعدة البيانات السويسري بروت. وكان من المتوقع الغشاء طوبولوجيا بواسطة برنامج SOSUI على أساس تحليل للا مائية كايت-دوليتل (23).
البقعة الغربية تحليل -A الأرنب بولكلونل الأجسام المضادة، ومكافحة NIPA1، أثيرت ضد حلقة الخلية الثالثة من نهائي المشقوق البروتين NIPA1 البشري باستخدام الببتيد الاصطناعية، NH 2 -AQDILHNNPSSQRALC-COOH (الأمينية بقايا حمض 207-222). وقد تضعف-تنقية تقارب أرنب الأجسام المضادة NIPA1 مكافحة الإنسان في برنامج تلفزيوني (المالحة تريس مخزنة، 20 م م تريس، 200 م م كلوريد الصوديوم، ودرجة الحموضة 7.6) تحتوي على 0.5٪ BSA بتركيز نهائي حوالي 0.7 ميكرولتر / مل. تم إجراء التحليل الغربي التي يحتضنها البقع مع anti-NIPA1 الأضداد بين عشية وضحاها في 4 درجات مئوية تليها ثلاث يغسل مع PBS، 0.1٪ توين 20، 10 دقيقة لكل منهما. ثم تم تحضين البقع مع 1/10000 الفجل-البيروكسيديز مترافق حمار المضادة للأرنب الثانوي (سيغما) الأجسام المضادة لمدة 1 ساعة. بعد غسل ثلاث مرات مع PBS / توين 20، 10 دقيقة لكل منهما، وتصور البقع مع ECL (أمرشام العلوم البيولوجية) وفقا لتعليمات الشركة الصانعة.
تم إصلاحها المناعي متحد البؤر المجهري -Coverslips من الخلايا المستزرعة في درجة حرارة الغرفة لمدة 10 دقيقة في 2٪ امتصاص العرق. تم غسلها الخلايا ثلاث مرات مع الفوسفات مخزنة المالحة التي تحتوي على 0.3٪ تريتون X-100 (PBST) قبل كل حضانة الأجسام المضادة. تم استخدام الأجسام المضادة الأولية التالية: NIPA1، GM130 (أ رابطة الدول المستقلة جولجي البروتين مصفوفة)، EEA1 (في وقت مبكر الاندوسوم مستضد 1)، Rab5 وRab8 (البروتينات ملزم GTP) التي أثيرت في الماوس (مختبرات BD تنبيغ). تم الحصول على اليكسا 350-، اليكسا 488- واليكسا الأجسام المضادة الثانوية 568-مترافق من المسابر الجزيئية. تم تنفيذ جميع ردود الفعل الأجسام المضادة في عرقلة الحل يتكون من 2٪ مصل الماعز العادي في PBST لمدة 1 ساعة درجة حرارة الغرفة. اليكسا 350- وphalloidin 568-مترافق (المسابر الجزيئية واستخدمت) وصمة عار لالأكتين في التجارب المشار إليها للمساعدة في ترسيم الطرفية الكشكشة الغشاء. بعد التلوين، coverslips ثم تم تركيبه على الشرائح مع المتوسطة المتزايدة على أساس الجلسرين-Fluoromount-G (التكنولوجيا الحيوية الجنوبية).
وقد شنت البويضات في أكتوبر ناظم البرد المتوسطة وفلاش المجمدة في isopentane تبريده في النيتروجين السائل. قطعت أقسام عشرة ميكرون سميكة من خلال البويضات المجمدة والتي شنت مباشرة على superfrost بالإضافة إلى الشرائح (فيشر). كانت ثابتة قسم -20 ° C الميثانول ومعالجتها لالمناعية باستخدام NIPA1 الأجسام المضادة الأولية والمضادة للأرنب اليكسا 488 الضد الثانوية.
وقد تم نقل كل الصور باستخدام عدسة 63 × المياه الملصقة على زايس LSM 510 المجهر ميتا وAxioVision (epifluorescent) أو LSM 510 ميتا (متحد البؤر) والبرمجيات. وقد تم اختيار الخلايا 10-12 الحقول النظر وتستخدم لتقييم التعاون توطين تلوين الأجسام المضادة.

النتائج

NIPA1 كدنا] هل لجين-المغنيسيوم استجابة، مع العلم أن الفرق التعبير الجيني تشارك مع مراقبة انتقائية من الظهارية الحفاظ على المغنيسيوم خلية، كانت استراتيجيتنا الرامية إلى استخدام التحليل ميكروأري لتحديد cDNAs التي كانت تصل التنظيم مع المغنيسيوم منخفضة (15). كما كان هدفنا لتحديد البروتينات الناقلة الجديدة، ونحن أولويات هؤلاء المرشحين وفقا لخصائص الهيكلية ذكرت لنقل افتراضية. كان واحدا من شظايا [كدنا المختارة التي حددها زيادة في نص NIPA2 (المصحف العضلة البروتين افتراضية MNCb-2146، والتي سميت Nipa2). أجري بحث BLAST قاعدة بيانات بنك الجينات ™ وعضو آخر من هذه العائلة، NIPA1، تم تحديد. كما كان NIPA1 ليس على الماوس Affymetrix MG U74 Bv2 والمصفوفات MG U74 Cv2 (Affymetrix) المستخدمة في ذلك الوقت من تحليلنا ميكروأري الأولي، ونحن أول أظهرت أن نص NIPA1، مثل NIPA2 مرنا، وينظم من قبل المغنيسيوم في الوقت الحقيقي باستخدام RT -PCR. زيادة NIPA1 مرنا 3.2 أضعاف في خلد أنبوبية الملتوية البعيدة، MDCT، الخلايا الظهارية، ن = 3 الاستعدادات مستقلة، مثقف في المغنيسيوم منخفضة مقارنة مع الخلايا الطبيعية مؤكدا أن NIPA1 ينظم بشكل مختلف من قبل المغنيسيوم.
الأحماض الأمينية تسلسل NIPA1 -THE الجينية للإنسان والفأر كل تحتوي على أربعة أفراد من عائلة حول و، المعين NIPA1-NIPA4. NIPA1 هو أقل أعضاء مماثل من الأسرة على الرغم من أنها تقع جنبا إلى جنب مع NIPA2 على الصبغي 15q. تم العثور على البروتينات NIPA1 الإنسان والفأر أن 98٪ متطابقة في تسلسل الأحماض الأمينية. وهي تختلف من المدى القصير من alanines على الطرف N-المحطة. وNIPA1 الإنسان والفأر NIPA1 عرضها بين 36 و هوية 43٪ إلى أخرى ثلاثة أشكال الإنسان والفأر حول و منها. الجينات التي تكود المتماثلات وثيقة (83-91٪ الهوية تسلسل الأحماض الأمينية) موجودة في الدجاج وانسان الغاب، وجينومات الشمبانزي، مشيرا إلى أن الاختلاف في NIPA1 من NIPA2، NIPA3، وكانت أشكال NIPA4 حدث في وقت مبكر من تطور الفقاريات (الشكل. 1 A).
لمحات للا مائية باستخدام برنامج SOSUI توقع هيكل الثانوية مع تسعة مجالات توقع الغشاء، TMDS (الشكل 1 B). يتضح أيضا هي T39R الماوس والمواقع طفرة G100R التي تتوافق مع T45R البشرية منها ومواقع طفرة G106R تقع في TMD1 توقع وTMD3، على التوالي (الشكل 1 B).
NIPA1 يتوسط المغنيسيوم 2 + النقل في التعبير عن القيطم البويضات -إلى تحديد ما إذا كان NIPA1 يشفر وظيفية المغنيسيوم 2+ نقل نحن كما يفعل NIPA2، 5 إعداد الماوس NIPA1 كرنا، حقنه في البويضات القيطم وقياس المغنيسيوم 2+ التيارات -evoked باستخدام اثنين من مسرى مكروي تحليل المشبك الجهد والمغنيسيوم 2+ تدفق باستخدام-2-ماج FURA منهجيات مضان. أعطى بيانات الكهربية دليل على وجود عملية rheogenic مع التيارات الداخل في البويضات NIPA1 كرنا حقن، في حين لم تكن هناك تيارات ملموسة في السيطرة H 2 O- أو بولي الكلي (A) + الخلايا حقن الحمض النووي الريبي من نفس دفعة من البويضات. الشكل . 1 C يظهر متوسط ​​الجهد الحالي (I-V) المؤامرات. كان هناك وسيلة + 28 بالسيارات التحول في إمكانية انعكاس مع زيادة العقد في تركيز المغنيسيوم، والذي يقترب من القيمة النظرية التي تنبأ بها العلاقة Nernstian. ومن بين الخصائص المتأصلة في جميع الناقلين هو ملك الركيزة التشبع. المغنيسيوم 2+ -evoked التيارات، ويقاس عند نقطة زمنية محددة، كانت القابل للإشباع (الشكل 1 D) مما يدل ثابت ميخائيل (K م) من 0.69 ± 0.21 م م (الشكل 1 D أقحم) التي كانت مستقلة عن أكبر الفولتية لقط السلبية (لا تظهر البيانات). وأكدت-2-ماج FURA قرارات مضان أن التيارات شاهدوها بسبب المغنيسيوم 2+ تدفق (الشكل 1 E). زيادة المغنيسيوم الخارجي نسبة انبعاث 340/385 الإثارة التالية المشبك الجهد في -70 بالسيارات. كاليفورنيا 2+ لم نقل بمعدلات اللازمة لتغيير كثافة مضان من صبغ وليس على المعدلات المطلوبة لحساب التيارات المقاسة بشكل متزامن.
المناعي باستخدام الأجسام المضادة المحددة لمكافحة NIPA1 يظهر في الغالب توطين سطح البروتين NIPA1 في البويضات NIPA1، معربا، في حين لم يكن هناك أي تلطيخ في السيطرة، البويضات حقن الماء (الشكل 1 F).
الخاصية الثانية من معظم شركات النقل هي الركيزة الانتقائية. وبناء على ذلك، تم استخدام مجموعة متنوعة من الكاتيونات ثنائي التكافؤ خارج الخلية لتحديد الانتقائية للقناة NIPA1 التعبير عنها. كان NIPA1 انتقائية نسبيا المغنيسيوم 2+ (تكميلية الشكل S1). وكانت نسبة الانعكاس المحتمل التيارات استرنشيوم 2+ -evoked اسيما أقل من المغنيسيوم 2+ ونسبة الكاتيونات ثنائي التكافؤ الأخرى اختبارها، كا 2+، ني 2+، الزنك 2+ الحديد 2+، النحاس 2+، شركة 2+، كان با 2+، والمنغنيز 2+، صغيرة بالمقارنة مع تلك التي حركها المغنيسيوم 2+ .Inthe التجارب أظهرت، تم تصحيح التيارات لإجراء تغييرات في مقاومة الغشاء الناجمة عن الموجبة ثنائي التكافؤ منها باستخدام القيم من H 2 البويضات حقن O (التكميلي الشكل . S1 A). وفقا لذلك، وكان النقل الموجبة NIPA1 بوساطة انتقائية نسبيا المغنيسيوم 2+.

الشكل 1.
التوصيف الجزيئي لNIPA1. شجرة النشوء والتطور التي شيدت من تشكيلة متعددة من الإنسان العاقل التالية (ح)، المصحف العضلة (م)، الجرذ النرويجي (ص)، جالوس جالوس (ز)، وعموم troglodytus (حزب العمال)، بونجو pygmaeus ( ع)، بوس توريس (ب)، وكلب familiaris (ج) تسلسل باستخدام ClustalX الإصدار 1.88 (21) وطريقة الانضمام جارة سيتو ونيي (22) باستخدام Phylo القرعة، الإصدار 0.8 (مختبر تطبيقات الرسومات، جامعة بوسان الوطنية ). توقع هيكل الثانوية من الماوس NIPA1. ويتضح موقعين طفرة الماوس، T39R وG100R، المقابلة لT45R وG106R الطفرات البشرية منها. الجهد الحالي (I-V) العلاقات التي تم الحصول عليها من الخطوات الجهد خطية من -150 بالسيارات إلى +25 بالسيارات في وجود ملغ 2+ حلول خالية أو تلك التي تحتوي على تركيزات المشار إليها من MgCl 2. وقد فرضت البويضات في إمكانية عقد -15 بالسيارات وكثف من -150 بالسيارات إلى +25 بالسيارات في 25 بالسيارات الزيادات لمدة 2 ق في كل من تركيزات المشار إليها. المعروضة هي متوسط ​​I -V المنحنيات التي تم الحصول عليها من سيطرة H 2 O-حقن = 3) أو => 3) البويضات، معربا عن NIPA1. لاحظ تحولا إيجابيا في إمكانية انعكاس مع زيادات في المغنيسيوم 2+ التركيز. القيم يعني ± SE من الملاحظات تقاس في نهاية كل الاجتياح الجهد لالمغنيسيوم 2+ تركيز كل منها. ملخص تعتمد على التركيز المغنيسيوم 2+ -evoked التيارات في البويضات NIPA1، معربا عن استخدام المحتمل عقد -125 بالسيارات. يعني القيم ± SE هي تلك الواردة في الشكل. 1 C. كان ثابت ميخائيل تحديدها مع غير الخطية anaylsis الانحدار 0.69 م م. كان ثابت ميخائيل مستقلة عن منهما عقد المحتملة. والمغنيسيوم 2+ تدفق إلى البويضات، معربا عن NIPA1. تم قياس-2-ماج FURA نسب مضان في السيطرة والبويضات NIPA1، معربا، في إمكانات يستريح، في الحلول التي تتكون من الحلول اسميا خالية من المغنيسيوم وثم مع 2.0 م م MgCl 2 مع انقطاع كما هو مبين. البويضات وبعد ذلك الجهد فرضت-في إمكانية عقد -70 بالسيارات، حيث المشار إليها. تم تحديد ملغ 2+ تدفقات مع مضان باستخدام ملغ 2+ صبغ -sensitive،-ماج FURA-2. CaCl 2، 2.0 م م، تم إضافة وإزالة الأماكن المحددة. يتم عرض النتائج على هيئة نسبة 340/385 الإثارة التي تعكس التغيرات في تركيز ثنائي التكافؤ الموجبة. النتائج الوسطية لاقتفاء أثر يؤديها مع ثلاثة الاستعدادات بويضة مختلفة. F والتعبير سطح البروتين NIPA1 في X. المورق البويضات مع تحديد المناعي. اللوحة اليمنى، ومراقبة البويضات حقن المياه اختبار مع NIPA1 محددة الأجسام المضادة تنقية تقارب. الأسهم تشير إلى سطح الغشاء (× 200 التكبير). اللوحة اليمنى البويضة NIPA1 حقن تعامل مع NIPA1 الضد يظهر تلوين سطح المكثف. وكان التيار قياس لهذه البويضة 0.12 أمبير مع 2.0 م م فرضت الخارجي تركيز MgCl 2 في -70 بالسيارات.


الشكل 2.
توزيع الأنسجة من الماوس الذاتية البروتين NIPA1 التعبير. اليسار، النشاف الغربي من البروتين NIPA1 الذاتية في الأنسجة الماوس المختلفة. تم تطبيق قسامة من البروتين (50 ميكروغرام) من الأنسجة الماوس اشارت الى كل حارة وlabbeled مع الأجسام المضادة بولكلونل محددة لNIPA1. هلام هو ممثل من ثلاثة الاستعدادات الأنسجة منفصلة. الحق، ويزيد من البروتين NIPA1 في الخلايا الظهارية مثقف في البلدان المنخفضة وسائل الإعلام المغنيسيوم. يظهر هو وصمة عار التمثيلية، واحدة من سبع أجريت على الاستعدادات مختلفة من الخلايا. زادت كثافة الفرقة متوسط ​​163 ± 7٪ مع المغنيسيوم منخفضة بالنسبة إلى تلك مثقف مع تركيزات عادية من المغنيسيوم.

وأخيرا، خاصية العامة للنقل هي القدرة على أن تحول دون ركائز ذات الصلة ولكن ليس نقلها. نحن اختبار إذا الكاتيونات التي لم نقلها بواسطة NIPA1 أن تمنع المغنيسيوم 2+ -evoked التيارات. تم اختبار تركيزات كبيرة نسبيا من 0.1 م م المنغنيز 2+ و 5.0 م م كا 2+ في وجود 2.0 م م MgCl 2 (الشكل S1 B). مليون 2+ تحول دون تماما المغنيسيوم 2+ التيارات، في حين كا 2+ لم تمنع النقل كما يتضح من التغيير في إمكانية انعكاس لالمغنيسيوم 2+. على التوازن، وهذه البيانات تشير إلى أن النقل NIPA1 بوساطة يوضح التشبع، والانتقائية، والقدرة على أن تحول دون تفاضلي قبل الكاتيونات ثنائي التكافؤ الأخرى.
توزيع أنسجة الذاتية NIPA1 البروتين التعبير التي تستخدم والوقت الحقيقي RT-PCR، وتبين لنا أن النصوص NIPA1 يتم التعبير على نطاق واسع بين الأنسجة الماوس اختبارها. وبعد ذلك قام تحليل لطخة غربية إلى تحديد الذاتية تعبير البروتين NIPA1 في مختلف الأنسجة الماوس (الشكل 2، يسار). للكشف عن البروتين NIPA1، تم إنشاؤها على الأجسام المضادة المحددة من قبل تحصين الأرانب. كان هناك فرقة واضحة في الكتلة الجزيئية المتوقع من 34 كيلو دالتون في القلب والكلى والكبد، والقولون، والفرقة خافت من 34 كيلو دالتون في الدماغ، وعدم وجود إشارة في الأمعاء الدقيقة. وكان من صدرة واضح في القلب والكلى الأنسجة التي قد توحي تعديل posttranslational في هذه الخلايا. بالإضافة إلى ذلك، كانت هناك عصابات باهتة في أنسجة القلب والكلى بنحو 68 كيلو دالتون وفرقة قوية جدا في الدماغ التي قد تمثل ديمر من البروتين. وكان هذا الأخير ثابت لمدة ثلاثة الاستعدادات الأنسجة منفصلة.
كما NIPA1 مرنا يستجيب لالمغنيسيوم، ونحن بعد ذلك تحديد NIPA1 تعبير البروتين في الخلايا المستزرعة في وسائل الإعلام المغنيسيوم منخفضة نسبة إلى المغنيسيوم العادي. باستخدام خط الخلية الكلى الماوس، MDCT، باعتبارها الخلايا الظهارية prototypic، كشف تحليل لطخة غربية عن زيادة بنسبة 2 أضعاف في كثافة البروتين في الخلايا المزروعة في المغنيسيوم منخفضة (الشكل يمين). ومن المثير للاهتمام، أن الزيادة السائدة في الفرقة 68 كيلو دالتون مع زيادات طفيفة في إشارة 34 كيلو دالتون. الفرقة أكبر، وربما متعدد القسيمات من البروتين NIPA1، قد يكون نقل نشط.
التعريب التحت خلوية من الذاتية NIPA1 البروتين -إلى تحقيق توطين التحت خلوية من البروتين NIPA1، أجرينا المناعي باستخدام محدد من الأجسام المضادة لمكافحة NIPA1 في الخلايا COS7 الكلى. NIPA1 على نطاق واسع شارك المترجمة مع EEA1 وRab5 التي هي بروتينات الاندوسوم في وقت مبكر (الشكل A و B). علاوة على ذلك، منقط نمط تلطيخ الطرفية من NIPA1 يتسق مع وجود NIPA1 في الإندوسومات مبكرة. لتثبت بشكل قاطع توطين NIPA1 إلى الإندوسومات في وقت مبكر، وهو شكل نشط بشكل جوهري من Rab5، Rab5Q79L، تم استخدامها. مترجمة شارك NIPA1 مع Rab5Q79L أعرب في الإندوسومات الموسعة (الشكل 3 B). بالإضافة إلى توطين endosomal، تم تفريق NIPA1 تلطيخ على نطاق واسع في جميع أنحاء سطح الخلية في الكشكشة الغشاء كما يتضح من phaloidin تلطيخ الأكتين (الشكل 3 C). إغفال من الأجسام المضادة الأولية أسفرت عن الغياب الكامل للالمناعية (لا تظهر البيانات). كما تم الكشف عن NIPA1 الذاتية مع الأجسام المضادة، وكان هذا النمط من التوزيع ليس الاستهداف غير الفعال للبروتين overexpressed الناتجة عن تعبير مغايرة. هذا النمط من التوزيع يتسق مع فكرة أن NIPA1 translocates من خلال الإندوسومات في وقت مبكر (وعلى الأرجح إعادة تدوير أيضا) وغشاء البلازما. يتم عرض النتائج من الخلايا COS7 هنا لأن عضية التقسيم داخل الخلايا كان من الأسهل تمييز مع المجهر متحد البؤر. ومع ذلك، لوحظت أنماط مماثلة من التوزيع مع HEK293 الكلى والخلايا MDCT (لا تظهر البيانات) والخلايا العصبية الحصين الابتدائية (التكميلي الشكل S2). كان NIPA1 واضح في نمط منقط في سوما والتشعبات من الخلايا العصبية مثقف وكان غائبا من مواقع متشابك (التكميلي الشكل S2). الاقتراح الذي NIPA1 الذاتية هي موجودة في غشاء سطح يتماشى مع الدراسات الفنية يؤديها مع البويضات معربا عن مغاير.

الشكل 3.
ويرد توطين التحت خلوية من NIPA1 الذاتية. المناعي تلطيخ الخلايا COS7. تم إصلاح الخلايا وحضنت مع الأجسام المضادة NIPA1 وعلامات الاندوسوم في وقت مبكر، EEA1 (A، اللوحة العلوية)، أو علامة جولجي، GM130 (A، لوحة الوسط) أو علامة TGN إعادة تدوير الاندوسوم، Rab8 (A، اللوحة السفلية). B، Rab5 (B، اللوحة العلوية) أو Rab5Q79L (B، اللوحة السفلية) استخدمت لتأكيد endosomal الترجمة. كانت ملطخة الخلايا COS7 مع phaloidin ل رسم سطح الخلية. يتم عرض تراكب في العمود الثالث من كل شخصية مع تضخم مقربة في العمود اليمين المتطرف. السهام تشير شارك توطين البروتين NIPA1 مع علامة منها. تم العثور على توزيعات التحت خلوية مماثلة في MDCT، HEK293، وخلايا الدماغ الحصين الابتدائية.

التغييرات في خارج الخلية المغنيسيوم يؤدي إلى تشارك إعادة التوزيع التحت خلوية من NIPA1 البروتين، إذا NIPA1 مع توازن المغنيسيوم الخلوي، فإننا نتوقع أنه قد يكون هناك إعادة توزيع التحت خلوية من البروتين في استجابة للتغيرات في تركيز المغنيسيوم الخارجي. كانت خلايا COS7 مثقف في المغنيسيوم عالية نسبيا، 5،0 م م MgCl 2، لمدة 3 أو 12 ساعة أو في أبعاده خالية من المغنيسيوم متوسطة لمدة 3 أو 12 ساعة، وتحدد توطين التحت خلوية مع المناعي على النحو الوارد أعلاه. حدثت تغييرات أكثر وضوحا في NIPA1 توزيع التحت خلوية داخل غشاء السطحية والإندوسومات في وقت مبكر (الشكل 4 أ). NIPA1was انخفاض طفيف في الغشاء الطرفية الثقافة التالية في ارتفاع المغنيسيوم 2+. بالنسبة لتلك الخلايا المزروعة في وسائل الإعلام الثقافة العادية التي تحتوي على 0.5 م م المغنيسيوم، وخفض البروتين NIPA1 في الغشاء السطحي وزيادة في الإندوسومات في وقت مبكر (الشكل 4 B). كان هذا الاتجار واضح من السطح إلى الاندوسوم مقصورة مبكرة ملحوظ في 3 ساعة وضعت في 12 ساعة بعد التغيير إلى ارتفاع متوسط ​​المغنيسيوم. كان تراكم البروتين NIPA1 كبيرة بما يكفي لتبدو وكأنها "تجميع" من البروتين في الإندوسومات في وقت مبكر (التكميلي الشكل S3 A).
وضع الخلايا في المغنيسيوم منخفضة لمدة 3 و 12 ساعة أدت إلى زيادة في البروتين NIPA1 في التجمع الاندوسوم في وقت مبكر ولكن ليس التجميع بل كان أكثر منقط داخل الإندوسومات مكبرة مقارنة مع تلك التي لوحظت مع المغنيسيوم العادي (التكميلي الشكل S3 A). وعلاوة على ذلك، كان هناك توظيف ملحوظ من البروتين NIPA1 إلى غشاء سطح الذي كان واضحا في 3 ساعات وتميز في 12 ساعة بعد إزالة المغنيسيوم. في الواقع، كان وضع العلامات السطح مع NIPA1 واسعة حتى أن مخطط الخلية كان واضحا مما يشير إلى أنه تم توطين في غشاء البلازما (المشار إليها في الشكل 4 B).
الخسارة من وظيفة الطفرات من NIPA1 البروتين -Rainer وآخرون. (9) التعرف على استبدال النوكليوتيدات في موقف 134 من NIPA1 [كدنا أن أدى إلى استبدال الحمض الأميني في موقف 45 من البروتين NIPA1 (T45R) في HSP المشابهة. هذا الموقع يتوافق مع وضع الثريونين 39 من NIPA1 الماوس. تحدث الطفرة T39R في بقايا المحفوظة في واجهة أول نطاق الغشاء (TMD1) وأول حلقة المفترضة (الشكل 1 B). ومن المتوقع أن يمدد هذه أول TMD من قبل ثلاثة أحماض أمينية يمكن أن يغير الاتجار البروتين أو وظيفة النقل. لاختبار هذا، فإننا استبدال منتدى المجالس الرومانسية 39 (ACG) مع الارجنتين 39 (AGG) وحقن كرنا المرتبطة إلى البويضات وأداء المشبك الجهد والتحليل مضان. طفرة T39R أدى إلى تقلص المغنيسيوم 2+ النقل بنحو 30٪ مقارنة مع NIPA1 من النوع البري على النحو الذي يحدده على حد سواء الكهربية (الشكل 5 A) وماج FURA-2 مضان (الشكل 5 B). يمكن أن يكون سبب هذه النتيجة عن طريق إما فشل نقل حركة المرور بشكل صحيح إلى غشاء البلازما أو عن طريق نقل أن حركة المرور بشكل طبيعي ولكنها غير وظيفية. للتمييز بين هذه الاحتمالات، وتنصهر من النوع البري NIPA1 وNIPA1T39R متحولة مع HA بحيث يمكن تقييم التعبير سطح الخلية في الخلايا COS7 عابر. من خلال تقنيات المناعي. وأعرب البرية من نوع NIPA1-HA في الإندوسومات المبكر، وكذلك سطح الخلية بطريقة مماثلة كما رأينا مع المناعي مع الأجسام المضادة NIPA1 (الشكل 5 C). كان غشاء البلازما NIPA1T39R-HA أقل بشكل ملحوظ من النوع البري الخلايا NIPA1-HA transfected، وكان هناك الاحتفاظ كبيرا من بناء متحولة في بنية تشبه شبكة محيط بالنواة تضم الشبكة الإندوبلازمية (الشكل 5 D). يتم تحديد البروتينات الخاطئة وتتجمع بواسطة الباطنة مراقبة الجودة شبكية. كان هناك أيضا زيادة واضحة في حجم endosomal قد توحي معالجة بروتين غير طبيعي داخل الإندوسومات (الشكل 5 E).

الشكل (4).
إعادة توزيع التحت خلوية من NIPA1 ردا على المغنيسيوم. كانت خلايا COS7 مثقف في المغنيسيوم عالية، 5.0 م م، المغنيسيوم العادي، 0.8 م م، أو المغنيسيوم المنخفض، أبعاده خالية من المغنيسيوم، لمدة 12 ساعة. تم تنفيذ المناعي مع NIPA1 الأجسام المضادة وعلامة السطح، phalloidin. وتظهر الصور المدمجة من الخلايا المسمى أيضا في لوحة اليمين المتطرف. ملخص تراكم NIPA1 في الغشاء الطرفية في استجابة للتغيرات في المغنيسيوم.


الشكل 5.
الخسارة من وظيفة الطفرات في NIPA1. ملخص المغنيسيوم 2+ -evoked التيارات في NIPA1T39R- والبويضات NIPA1G100R، معربا مقارنة مع من النوع البري البويضات، معربا عن NIPA1. تم قياس التيارات مع 2.0 م م MgCl 2 في الجهد إجراء 100 بالسيارات وفقا لأساليب معينة في وسيلة الإيضاح إلى الشكل. غادر. النتائج يعني ± SE ل n = 7، 10، و 7 البويضات، على التوالي. المغنيسيوم 2+ تدفق، والتي تحددها-ماج FURA-2 مضان، إلى البويضات NIPA1T39R- وNIPA1G100R، معربا عن. وقد تم قياس تركيز ملغ 2+ مع 2.0 م م MgCl 2 وفقا لأساليب معينة في وسيلة الإيضاح إلى الشكل. والحق. النتائج سيلة لأربعة البويضات. صور المناعي من NIPA1-HA-، NIPA1T39R-HA-، أو NIPA1G100R-HA-معربا عن الخلايا COS7. ملخص NIPA1T39R-HA وNIPA1T100R-HA الاحتفاظ في الشبكة الإندوبلازمية (ER) نسبة إلى البرية من نوع NIPA1 البروتين. وزيادة في حجم endosomal من NIPA1T39R-HA وNIPA1T100R-HA transfected نسبة إلى البرية من نوع الخلايا COS7 NIPA1-HA transfected. WT، النوع البري.

القصب (10)، تشن (11)، مونهوز (12)، وزملائهم المعنية حددت إجراء تبديل مغلطة، G106R، في أربع أسر لا علاقة كبيرة مع HSP. طفرة G106R الإنسان يتوافق مع الماوس G100R (الشكل 1 B). يقع هذا التحول في المنطقة الأحماض الأمينية الحفظ جدا في الجزء المركزي من TMD الثالث بحيث يتوقع أن يغير كثيرا من بنية البروتين (10). لقد استبدلنا الغليسين 100 (GGG) مع الارجنتين 100 (AGG)، وحقن كرنا المرتبطة في البويضات. طفرة G100R تلغى تماما المغنيسيوم 2+ النقل على النحو الذي يحدده الكهربية أو ماج FURA-2 مضان (الشكل A و B). بالتنسيق مع هذه النتائج، تم الابقاء على NIPA1G100R-HA في الشبكة الإندوبلازمية وكان هناك الاتجار القليل من البروتين النقل إلى سطح الخلية (الشكل C و D). كما هو الحال مع متحولة T39R، كانت هناك زيادة في البروتين endosomal (الشكل 5 E). نخلص إلى أن التعبير سطح تقلص من NIPA1T39R وغياب النتائج البروتين NIPA1G100R في فقدان جزئي وكاملة من المغنيسيوم 2+ امتصاص، على التوالي، من هذه الأشكال متحولة اثنين.

نقاش

نعرض هنا أن NIPA1، أساس بعض أشكال HSP، يتوسط المغنيسيوم 2+ النقل. والدليل على أن NIPA1 هو نقل المغنيسيوم مقنعة. أولا، تعبيرا عن NIPA1 في البويضات القيطم تنتج المغنيسيوم 2+ التيارات -evoked مع خصائص القناة مثل قياس مع الظروف الجهد المشبك. عكس التحولات المحتملة للحق قوته 28 فولت كما تنبأ به علاقة نرنست مع زيادة العقد في تركيز المغنيسيوم. ملغ 2+ التيارات هي التي تعتمد على التركيز، وتشبع، عكسها، وinhibitable كما هو متوقع لنقل القناة مثل. ثانيا، NIPA1 يتوسط المغنيسيوم 2+ تدفق على النحو الذي يحدده مضان مع المغنيسيوم 2+ -sensitive ماج-FURA-2 الصبغة. ثالثا، NIPA1 نص والبروتين وتغييرها كميا مع التغيرات في المغنيسيوم 2+ التركيز، وتتفق مع النموذج الأولي لدينا (16). رابعا، علينا أن نبرهن على الاتجار NIPA1 إلى الإندوسومات المبكرة والبلازما الغشاء تزداد مع تقلص خارج الخلية المغنيسيوم 2+، كما هو متوقع من نقل التنظيم المغنيسيوم. وأخيرا، وتبين لنا أن NIPA1T38R وNIPA1G100R طفرات تؤدي إلى فقدان المغنيسيوم النقل 2+ في البويضات معربا عن NIPA1 تغييرها. نستنتج أن NIPA1 يشفر المغنيسيوم 2+ نقل. ما هو غير واضح هو كيف يمكن لNIPA1 الخسارة من وظيفة يمكن أن تؤدي إلى فرط الاستثارية شبكة غير قادرة على يسبب الشلل النصفي التشنجي.
راينر وآخرون. (9) وتشاي وآخرون. (5) وأفادت وجود اثنين من النصوص NIPA1، 1،9-2،2 و 7.5 كيلوبايت، في الإنسان والفأر (5، 9). دعت إيسفورمس مرنا بديلة من مواقع تذييل بعديد الأدينيلات بديلة له داخل اكسون 5 (5). وأعرب الرنا اثنين جوهري في جميع أنسجة اختبار ولكنها أثرت خصوصا في أنسجة المخ (5، 9). نتائجنا باستخدام التحليل الغربي تتفق مع هذه الملاحظات السابقة. باستخدام الأجسام المضادة بولكلونل المحددة التي ولدت لنا في الأرانب، وتبين لنا هنا أن البروتين NIPA1 الذاتية موجود في العديد من الأنسجة ولكن وفرة خاصة في الدماغ. ومن المثير للاهتمام، وشكل كبير في خلايا المخ ويبدو أن حوالي ضعف حجم الجزيئي وتوقع من تسلسل الأحماض الأمينية يمكن أن يوحي أنه قد يكون ديمر. العديد من مستقبلات غشاء، النقل، وبروتينات الغشاء لا يتجزأ تتطلب dimerization أو أعلى oligomerization لنشاطهم.
ردا على المغنيسيوم منخفض، كانت هناك زيادة 65٪ في البروتين NIPA1 في خلايا الكلى الماوس. وعلاوة على ذلك، كانت الزيادة أساسا في شكل 68 كيلو دالتون مع زيادات أصغر بكثير في الحجم 34 كيلو دالتون. نحن التكهن بأن النموذج النشط لنقل NIPA1 هو أكبر الأنواع بروتين dimerized. وأعرب عن بوفرة في الخلايا الظهارية المستزرعة في المغنيسيوم منخفضة مقترن النقل مرتفعة المغنيسيوم 2+. وبناء على ملاحظة أن النموذج في خلايا الدماغ الطبيعية هو في المقام الأول أكبر حجم 68 كيلو دالتون، ونحن التكهن أيضا أن نقل NIPA1 نشط بشكل جوهري في الأنسجة العصبية.
داخل الخلية، والمترجمة البروتين NIPA1 أساسا في المقصورة endosomal المبكرة والسطح المحيطي. كان هناك القليل جدا من البروتين الموجود في النواة، الشبكة الإندوبلازمية، جولجي، أو الإندوسومات المتأخرة وlysozomes. وتشير هذه الترجمة أن البروتين NIPA1 يلعب دورا في الغشاء السطحي. ودعما لهذه الفكرة هو إعادة توزيع NIPA1 ردا على المغنيسيوم. كان هناك تهريب واضح من على سطح الأرض والتجميع في الإندوسومات في الخلايا المستزرعة في المغنيسيوم عالية، في حين كانت هناك حركة ملحوظة من NIPA1 إلى المحيط مع المغنيسيوم منخفضة. تتفق مع التحليل الغربي، كانت هناك زيادة ملحوظة في إجمالي البروتين في الخلايا الظهارية التي تزرع في المغنيسيوم منخفضة وتجميع واضح من البروتين NIPA1 في الإندوسومات مبكرة إعطاء مظهر منقط. نستنتج أن المغنيسيوم عالية يؤدي إلى التعبير سطح تقلص من البروتين NIPA1 وعزله في حين الإندوسومات النتائج المغنيسيوم المنخفضة في زيادة endosomal أوائل البروتين NIPA1 وتعزيز استهداف لغشاء السطح. هذه التغييرات في حساب المرجح البروتين التعبير، في جزء منه، ليرتبط بها من تغيرات في النقل المغنيسيوم 2+.
وأخيرا، وتبين لنا أن NIPA1T38R وNIPA1G100R طفرات تؤدي إلى فقدان المغنيسيوم النقل 2+ في البويضات معربا عن NIPA1 تغييرها. الطفرات مغلطة G100R وT45R تؤدي إلى وظيفة الخسارة من ويوحي بأن G100 والمواقع T45 مهمة، إن لم يكن من الضروري، في تجهيز NIPA1 المغنيسيوم 2+ البروتين النقل. وعلاوة على ذلك، الغليسين يتم حفظها 106 والثريونين 45 بين القنوات NIPA1 ortholog يدعم فكرة أن الطفرة إمراضي بقوة. وفي الآونة الأخيرة، كانت هناك طفرة أخرى، A100T، وذكرت في عائلة عرض مع النمط الظاهري HSP (19). تبقى التغييرات في النقل يحدد لاحقا. لا توجد مواقع الإجماع مماثلة في سائر أعضاء الأسرة حول و، إما NIPA2 paralog أو NIPA3 ذات الصلة وNIPA4، بحيث البروتين للطي يختلف المحتمل بين هذه الناقلين. تبقى أهمية هذه الاختلافات في أداء الفيزيائية الحيوية للنقل حول و لفحصها. ومن المثير للاهتمام أيضا أن G106R يؤدي إلى استكمال الخسارة من وظيفة في حين T45R يتوسط بعض المغنيسيوم 2+ النقل. سيكون من المثير للاهتمام أن نرى ما اذا كان هناك اختلافات في الأعراض السريرية بين هاتين المجموعتين من المرضى HSP.
وتشير النتائج الحالية التي NIPA1 يشكل المغنيسيوم 2+ نقل. كيف يمكن ان يكون عيب المغنيسيوم 2+ نقل يؤدي إلى النمط الظاهري للHSP غير واضح. بالإضافة إلى انخفاض تدريجي التشنج أطرافهم، وبعض الموضوعات مع غير معقدة HSP لها الإلحاح البولي ومعتدل انخفاض اهتزازي الإحساس في أصابع القدم (9). على حد علمنا، لم يتم الإبلاغ عن اضطرابات في عملية الأيض المغنيسيوم في هؤلاء الأفراد ولا له تأثير مكملات المغنيسيوم تم تقييمها. أيضا من الفائدة هو السبب المرتبطة NIPA1 HSP المرضى الحالي مع الأعراض في سن المراهقة أو الكبار سنواتهم بدلا من الرضاعة أو الطفولة (6). قد تشير إلى سيطرة المرتبطة بالعمر أو الزمانية لNIPA1 التعبير الجيني. وعلاوة على ذلك، لأن HSP هو مجموعة سريريا وغير متجانسة وراثيا من الاضطرابات العصبية، فمن المرجح أن العديد من العوامل وجينات أخرى يمكن أن تسهم في توليد الظواهر الاستيلاء وحظ في الطيف HSP (20). باستخدام التصوير بالرنين المغناطيسي، والخضيرة وآخرون. (20) في الآونة الأخيرة أنه ضمور النخاع الشوكي في وقت مبكر وشديد يحدث في المرضى الذين يعانون NIPA1-HSP بسبب فقدان محور عصبي مما يشير إلى انحطاط تنازلي مساحات الحبل الشوكي التعصيب السفلية. ومن المثير للاهتمام، لم تحليل الدماغ لم تكشف عن أي تشوهات دائمة من شأنها أن تميز المرضى NIPA1 طفرة HSP من السيطرة على المجموعة. وبناء على ذلك، فإنه من الصعب التكهن على وظيفة NIPA1 في الدماغ والحبل الشوكي أو خلايا nonneural أخرى حيث وجدت.
نستنتج من الدراسات الحالية أن NIPA1 يشفر عادة المغنيسيوم 2+ نقل وفقدان للوظيفة NIPA1 (SPG6) بسبب mistrafficking من البروتين تحور يوفر الأساس لالنمط الظاهري HSP.

 

__________________
استشارى الادوية الطبيعيه وباحث وخبير فى علاجات التوحد
رد مع اقتباس
إضافة رد

أدوات الموضوع
طريقة عرض الموضوع

تعليمات المشاركة
لا تستطيع إضافة مواضيع جديدة
لا تستطيع الرد على المواضيع
لا تستطيع إرفاق ملفات
لا تستطيع تعديل مشاركاتك

BB code is متاحة
كود [IMG] متاحة
كود HTML معطلة

الانتقال السريع


 المكتبة العلمية | المنتدى | دليل المواقع المقالات | ندوات ومؤتمرات | المجلات | دليل الخدمات | الصلب المشقوق وعيوب العمود الفقري | التوحد وطيف التوحد  | متلازمة داون | العوق الفكري | الشلل الدماغي | الصرع والتشنج | السمع والتخاطب | الاستشارات | صحة الوليد | صحة الطفل | أمراض الأطفال | سلوكيات الطفل | مشاكل النوم | الـربـو | الحساسية | أمراض الدم | التدخل المبكر | الشفة الارنبية وشق الحنك | السكري لدى الأطفال | فرط الحركة وقلة النشاط | التبول الليلي اللاإرادي | صعوبات التعلم | العوق الحركي | العوق البصري | الدمج التربوي | المتلازمات | الإرشاد الأسري | امراض الروماتيزم | الصلب المشقوق | القدم السكرية



الساعة الآن 04:53 PM.