منتدى أطفال الخليج ذوي الاحتياجات الخاصة

منتدى أطفال الخليج ذوي الاحتياجات الخاصة (http://www.gulfkids.com/vb/index.php)
-   صعوبات التعلم (http://www.gulfkids.com/vb/forumdisplay.php?f=11)
-   -   متلازمة بارديه-بيدل (http://www.gulfkids.com/vb/showthread.php?t=16672)

رافت ابراهيم 11-23-2015 07:50 PM

متلازمة بارديه-بيدل
التفاعل الوراثي للBBS1 الطفرات مع الأليلات في باقي BBS الامكنه يمكن أن يؤدي إلى غير مندلية بارديه-بيدل متلازمة

فيليب لام Beales1، *، خوسيه L. Badano3، *، أليسون J. Ross1، ستيفن J. Ansley3، بيثان E. Hoskins1، بريجيتا Kirsten2، تشارلز A. Mein2، فيليب Froguel2، 5، بيتر J. Scambler1، ريتشارد آلان Lewis6 ، 7، 8، 9، جيمس R. Lupski6، 8، نيكولاس Katsanis3، 4،،

متلازمة بارديه-بيدل هو اضطراب وراثيا وغير متجانسة سريريا التي تسببها طفرات في لا يقل عن سبعة مواضع (BBS1-7)، خمسة منها يتم استنساخ (BBS1، BBS2، BBS4، BBS6، وBBS7). وقد أشارت التحليلات الوراثية وطفرية أنه في بعض الأسر، وهو مزيج من ثلاثة الأليلات الطافرة على اثنين من مواضع (الميراث triallelic) ضروري لالمرضية. حتى الآن، أربعة مواضع BBS المعروفة الخمس قد تورطت في هذا النمط من انتقال المرض قليل الجينات. نقدم تحليلا شاملا لطيف، والتوزيع، والمشاركة في نقل سمة غير مندلية الأليلات الطافرة في BBS1، موضع BBS الأكثر شيوعا. تحليلات 259 أسرة مستقلة عزل النمط الظاهري BBS تشير إلى أن BBS1 تشارك في الميراث معقدة، وأنه في عائلات مختلفة، والطفرات في BBS1 يمكن أن تتفاعل وراثيا مع الطفرات في كل من غيرها من الجينات BBS المعروفة، وكذلك في مواضع غير معروف، لتتسبب في النمط الظاهري. وتمشيا مع هذا النموذج، حددنا الأليلات M390R متماثل، طفرة BBS1 الأكثر شيوعا، في الأفراد غير متناظرة في عائلتين. وعلاوة على ذلك، التحليلات الإحصائية لدينا تشير إلى أن انتشار أليل M390R في عموم السكان يتسق مع قليل الجينات بدلا من نموذج المتنحية من انتقال المرض. ويشير توزيع BBS الأليلات قليل الجينات أيضا أن جميع مواضع BBS قد تتفاعل وراثيا مع بعضها البعض، ولكن بعض الجينات، وخاصة BBS2 وBBS6، هم أكثر عرضة للمشاركة في الميراث triallelic، مما يشير إلى قدرة متغيرة من البروتينات BBS للتفاعل وراثيا مع بعضها آخر.

يحدث الميراث قليل الجينات عندما أليل محددة في مكان واحد أو أكثر تؤثر على سمة وراثية عن طريق التسبب و / أو تعديل شدة ونطاق النمط الظاهري. وقد اقترح عدد التوسع السريع للجينات المسببة للأمراض المعروفة وتحسين فهم الأسس الخلوية آليات طفرية أن العديد من الاضطرابات يعتقدون في السابق أن تكون أحادية المنشأ هي، بالأحرى، منتجات التفاعل الجيني لعدد صغير من مواضع (Badano و Katsanis 2002؛ مينغ وMuenke 2002).

متلازمة بارديه-بيدل (BBS [MIM ​​209900]) هو اضطراب عديد المظاهر غير متجانسة سريريا تتميز التدريجي ضمور شبكية العين، والسمنة المركزية، polydactyly، وخلل التنسج الكلوي، وتشوهات الجهاز التناسلي، وضعف الادراك (Schachat وMaumenee 1982؛ الأخضر وآخرون 1989) . وتتضمن الميزات الإضافية قصر القامة، endocrinopathies (بما في ذلك مرض السكري وقصور الغدة الدرقية)، وتشوهات خلقية في القلب، وكذلك الكلام واضطرابات سلوكية (الأخضر وآخرون 1989؛. Beales وآخرون 1999). BBS هو أيضا غير متجانسة وراثيا. على أساس وراثي نموذج انتقال المتنحية، تم تعيين سبعة مواضع في الجينوم: BBS1 على 11q13 (ليبرت وآخرون 1994)، BBS2 على 16q21 (Kwitek الأسود وآخرون 1993)، BBS3 على 3p12 (شيفيلد وآخرون 1994)، BBS4 على 15q22.2-Q23 (كرمي وآخرون 1995)، BBS5 على 2q31 (يونغ وآخرون 1999a)، BBS6 على 20p12 (Katsanis وآخرون 2000)، وBBS7 على 4q27 (Badano وآخرون. 2003). ومع ذلك، فإن استنساخ أول مكان BBS، BBS6 (Katsanis وآخرون 2000؛. Slavotinek وآخرون 2000)، تليها الطفرات يحلل على الفوج متعددة الأعراق كبيرة، يعني أن بعض الطفرات لا تتفق مع النموذج التقليدي للمرض وراثي جسمي مقهور نقل (Beales وآخرون 2001). بعد التعرف على اثنين إضافيين BBS مواضع، BBS2 (نيشيمورا وآخرون 2001) وBBS4 (Mykytyn وآخرون 2001)، وتسلسل أظهرت تحاليل أنه في بعض الأسر، أي ما مجموعه ثلاثة طفرات في اثنين من الجينات ضرورية لإمراض (Katsanis وآخرون 2001a، 2002)، وبالتالي إنشاء نموذج triallelic انتقال المرض ومما يدل على أن BBS قد تكون نموذجا مفيدا لدراسة الصفات قليل الجينات (Badano وKatsanis 2002).

وفي الآونة الأخيرة، تم استنساخ اثنين من الجينات BBS جديدة: BBS1 (Mykytyn وآخرون 2002). وBBS7 (Badano وآخرون 2003)، كل ترميز البروتين من وظيفة غير معروفة ولكن العارضة التشابه متواضع إلى أخرى. اقترح تحليل طفرية من BBS7 أن هذا الموضع قد يشارك أيضا في الميراث غير مندلية. ومع ذلك، فإن التحليلات الأولية المبلغ عنها BBS1 في 60 أسرة مع BBS لم تسفر عن أي دليل على الميراث triallelic، لأن كل من غياب المرضى الذين يعانون من ثلاث طفرات على اثنين من مواضع وعدم وجود الأفراد غير متناظرة مع اثنين من الطفرات BBS1 (Mykytyn وآخرون 2002) .

أجرينا تحاليل وراثية وطفرة شاملة من 259 أسرة، من مختلف الأعراق، مع BBS ووصف خصائص، والتردد، والموقف من الطفرات BBS1. توفر البيانات لدينا أدلة دامغة على مشاركة BBS1 في الميراث triallelic وتشير إلى أن BBS يمكن أن تنشأ من المزاوجة بين مجموعات مختلفة من الطفرات التي في كل مكان يمكن أن تسهم إما واحد أو اثنين من الأليلات الطافرة على ترددات مختلفة.
المرضى وطرق

ومائتان وتسعة وخمسين الأسر التي لديها BBS، من أصول عرقية مختلفة، تم فحص للطفرات في BBS1. واستند تشخيص BBS على المعايير المحددة التي تتطلب أن أربعة من ستة الميزات الأساسية تكون موجودة (اندرسون لويس 1997؛. Beales وآخرون 1999). في العديد من الحالات، تم التأكد من التشخيص من قبل الأطباء المحليين والتحقق منها من خلال فحص السجلات الطبية من جانب واحد أو أكثر منا (RAL، PLB). تم الحصول على الدم مع الموافقة، وفقا للبروتوكولات التي وافق عليها المواضيع الإنسان لجان أخلاقيات المناسبة في كل مؤسسة مشاركة، وتم استخراج DNA كما هو موضح في مكان آخر (Katsanis وآخرون 2000).
التحليل الجيني والطفرات

تم محاذاة تسلسل [كدنا المبلغ عنها BBS1 (بنك الجينات عدد الانضمام AF503941) (Mykytyn وآخرون 2002) لتسلسل الجينوم من الجمعية الجينوم البشري يونيو 2002 مع الخوارزمية BLAT النوكليوتيدات-النوكليوتيدات في جامعة كاليفورنيا في سانتا كروز. نحن مصممون حدود إنترون-إكسون لمدة 17 الإكسونات، وهو ما يتسق مع البيانات التي تم نشرها. استخرجنا 100-300 نقطة أساس تسلسل المرافقة كل اكسون الترميز وamplicons المصممة التي تمتد كل اكسون وكلا تقاطعات لصق، كما هو موضح في مكان آخر (Katsanis وآخرون 2000). نحن تنقية المنتجات PCR تضخيمها من المرضى وأقاربهم، والضوابط لا علاقة لها لكن عرقيا المتطابقة، سواء مع عدة إكسو-SAP تنظيف (USB) أو تنقية QIAquick كيت PCR (QIAGEN)، ويقوم التسلسل المباشر لمنتجات PCR مع dye- التمهيدي (النظم البيولوجية التطبيقية) أو صبغ فاصل (أمرشام العلوم البيولوجية أو النظم البيولوجية التطبيقية) الكيمياء. تم إجراء تسلسل على محلل ABI 377 وABI 3700 تسلسل (النظم البيولوجية التطبيقية) أو محلل تسلسل MegaBACE1000 (أمرشام العلوم البيولوجية).

أجرينا تحاليل وراثية عن طريق توليد الأنماط الجينية لكل مريض أو قريب الصلة مع تقارير المعاملات المشبوهة الفلورسنت وبناء النسخ المتنوعة عبر كل مكان BBS، كما هو موضح في مكان آخر (Katsanis وآخرون 1999؛. Beales وآخرون 2001). وقد تم الحصول على تسلسل الصغرية من أي قاعدة بيانات الجينوم أو مركز ايتهيد معهد للبحوث الجينوم.
تحليلات حفظ التطورية

تعرفنا على البطن ذبابة الفاكهة، ايليجانس Caenorhibditis، المصحف العضلة، الجرذ النرويجي، وorthologs دانيو rerio من BBS1، BBS2، BBS4، وBBS6 من خلال أداة بحث للSwissprot وTrembl مع تسلسل الببتيد البشري. تم محاذاة متواليات مع البرنامج ClustalW للعودة إلى تمثيل رسومي للمخلفات الحفظ وnonconserved. حددنا أيضا تسلسل جزئية من scrofa سوس، بوس الثور، القيطم المورق، وجالوس orthologs جالوس من BBS6 عن طريق إجراء عمليات البحث TBLASTN من تسلسل الببتيد BBS6 ضد / nonmouse قاعدة بيانات EST غير البشرية. نحن محاذاة متواليات ذات الصلة مع البرامج من حزمة تحليل GCG البرامج v.9.0، كما هو موضح في مكان آخر (Katsanis وفيشر 1998).
طيف BBS1 الطفرات

لتحديد مدى ونوع من الطفرات في BBS1، ونحن التسلسل ما مجموعه 259 أسرة من مختلف الأعراق، والتي قسمت إلى قسمين الأفواج اعتمادا على المختبر مسؤول عن جمع والحفاظ على مخزونات DNA: لفيف الولايات المتحدة (147 أسرة) و فوج المملكة المتحدة (112 أسرة). وعلاوة على ذلك، بسبب الميراث معقدة من BBS (Katsanis آخرون 2001a، 2002)، ونحن التحقيق في جميع الأسر المتاحة بغض النظر عن البيانات الوراثية أو طفرية السابقة.

حددنا العديد من التعديلات، وهو ما حقق زيادة لالمرضية التي كتبها (أ) فصل بينها وبين النمط الظاهري في الأسر. (ب) التأكد مما إذا كانوا قد تعطل الربط. (ج) تقييم ما إذا كانت تمثل استبدال حمض أميني غير محافظ أو توقع سابق لأوانه إنهاء كودون. (د) التحقيق في ما إذا كانت موجودة في 200-400 غير ذات صلة، الكروموسومات السيطرة عرقيا يقابل. و (ه) تحديد مستوى الحفظ التطوري لكل بقايا.

عموما، اكتشفنا واحد على الأقل طفرة BBS1 المرتبطة المرض في 60 من 259 الأنساب (23.2٪ من الأسر، و 111 أليل متحولة) (الجدولين 1 و 2)، على الرغم من توقع ~40٪ -56٪ من الأليلات المرتبطة المرض، بناء على التحليلات السابقة من مساهمة هذا الموضع إلى BBS من قبلنا وغيرها (Bruford وآخرون 1997؛. Katsanis وآخرون 1999). من 24 مختلفة الأليلات BBS1 متحولة الكشف في بلدينا الأفواج، 2 كانت لصق الطفرات مفرق و 5 كانت الإدراج أو الحذف (الجدول 2). واحد من هؤلاء هو حذف 3-BP القضاء على يسوليوكيني في موقف 389، في حين أن الأربعة الأخرى نتيجة المفهوم في انزياح الإطار وإنهاء السابق لأوانه ترجمة الببتيد المشفرة. وكانت معظم التغييرات إما التحولات 1-BP أو transversions مما أدى إلى استبدال مغلطة (ن = 9) أو الطفرات هراء إدخال كودون وقف المبكرة (ن = 8). كان واحدا من الطفرات مغلطة إجراء تبديل 2-BP متجاورة، TT → AC (L503H)؛ وأشار subcloning وتسلسل كل أليل لاحق أن التعديلات اثنين تكمن في نفس حبلا، واحتلال المناصب الثانية والثالثة في نفس كودون.

باستثناء أليل متحولة M390R، تم العثور على معظم الطفرات في التردد المنخفض في كل فوج (الجدول 2). فقط أليل واحد، D148N، تم العثور في كل من جمع المريض المملكة المتحدة والولايات المتحدة، على الرغم من أن معدل انتشار بعض الطفرات رقي في واحد أو جماعة أخرى (على سبيل المثال، أربعة الأليلات R146X الولايات المتحدة وثلاثة الأليلات Y284fsX288 UK)، مما يوحي بأن كل مريض جمع قد يكون له التركيب الجيني متميزة. والجدير بالذكر، تم الكشف عن الطفرات BBS1 في المقام الأول في الأسر البيضاء. فقط 2 من 24 عائلة من أصل السعودي كان الطفرات BBS1 (8٪)، وعلى النقيض من ~20٪ من البيض، مشيرا إلى أن BBS1 قد لا يكون موضع BBS رئيسيا في هذه الفئة من السكان.

رسم موقف الطفرات في BBS1 كشفت عن وجود توزيع غير منتظم (الشكل 1)، والتي لا أحد من 26 الطفرات يكمن في المدقع N أو C تيرميني من البروتين المتوقعة. وبالإضافة إلى ذلك، فإن المنطقة التي تمتد من اكسون 6 إلى 9 اكسون تخلو من الطفرات، باستثناء أليل واحد، E234K.

توزيع الطفرات على طول BBS1. وصفت الإكسونات كما أشرطة زرقاء و ...
الشكل 1.

توزيع الطفرات على طول BBS1. وصفت الإكسونات كما أشرطة زرقاء وموقف كل طفرة يظهر أعلاه. السهام تشير إلى مواقف بدء وإنهاء الكودونات، في حين تشير العلامات النجمية الطفرات ذكر سابقا من قبل Mykytyn وآخرون. (2002)؛ المقياس هو تقريبي. البروتين BBS1 لا يوجد لديه المجالات ملحوظ، باستثناء منطقة التشابه بين بقايا 187-377 مع BBS2 وBBS7 التي يحتمل أن يشفر ستة البيضاء-β-المروحة (Badano وآخرون 2003).
خيارات الشكل

M390R هو السائد BBS1 الطفرة

وأشارت التحليلات طفرية السابقة من فوج أصغر المرضى أن تغيير مغلطة واحد في اكسون 12 من BBS1، M390R، هو الأكثر شيوعا BBS1 أليل متحولة، وهو ما يمثل 32٪ (38/120 أليل متحولة، في ظل افتراض نموذج المتنحية حصرا) جميع الطفرات BBS (Mykytyn وآخرون 2002). على الرغم من أن مساهمة M390R إلى BBS في فوج لدينا أقل (18٪)، وجدنا أليل M390R أن تكون الطفرة BBS1 الأكثر شيوعا في كل من الأفواج لدينا. في فوج الولايات المتحدة، M390R هي موجودة في 75.7٪ من مجموع الأسر مع الطفرات BBS1، و، في الفوج المملكة المتحدة، لاحظنا نسبة أعلى قليلا من 82.6٪ (جدول 4). عموما، كانت 45٪ من الأنساب مع الطفرات BBS1 متماثل للالنوكليوتيدات G (أرجينين ترميز)، في حين أن 33.3٪ منهم متخالف. كشفت تحليلات مستقلة عن بعضها الفوج المريض أيضا تخصيب طفيف للالزيجوت M390R (40.5٪) مقارنة مع أصحاب الزيجوت المتماثلة الألائل (35.1٪) في فوج الولايات المتحدة، على النقيض من الفوج المملكة المتحدة، التي الزيجوت المتماثلة الألائل (60.9٪) أكثر من مرتين المشتركة كما كما الزيجوت (21.7٪). قد يكون هذا الاختلاف يرجع، في جزء منه، إلى العرق الخلفية اثنين من المجموعات العائلية؛ في كل فوج، تم العثور على أليل M390R على وجه الحصر تقريبا في الأنساب من أصل أوروبي. هذه الملاحظة، إلى جانب ارتفاع وتيرة هذا الأليل في BBS، تشير إلى أن M390R قد يكون مؤسس القديم، نشر من خلال السكان إما عن طريق الانجراف الوراثي أو بعض ميزة انتقائية كما ولكن في ذات مجهولة الهوية في حالة متخالف.

جدول (4).

النسبي انتشار وتوزيع M390R أليل
البيانات في الفوج
المملكة المتحدة. الولايات المتحدة المشتركة M390R انتشار
M390R الحالة رقم الأسر التي لديها BBS1 الطفرات (ن = 23)٪ من جميع الأسر التي لديها BBS1 الطفرات عدد الأسر التي لديها BBS1 الطفرات (ن = 37)٪ من جميع الأسر التي لديها BBS1 الطفرات عدد الأسر التي لديها BBS1 الطفرات (ن = 60)٪ من جميع الأسر التي لديها BBS1 الطفرات عدد الأسر (ن = 259)٪ من جميع الأسر التي لديها BBS
أصحاب الزيجوت المتماثلة الألائل 14 60.9 13 35.1 27 45.0 27 10.4
الزيجوت 5 21.7 15 40.5 20 33.3 20 7.7
المجموع 19 82.6 28 75.7 47 78.3 47 18.1
M390R والطفرات elsewherea 4 5 17.4 13.5 15.0 9 9 3.5


كما تم احتساب هذه العائلات كما الزيجوت المتماثلة الألائل M390R والزيجوت، اعتمادا على النمط الجيني لكل عائلة.

خيارات الجدول

تقييم الإرث مجمع في BBS1

توافر 259 أسر مع BBS، مع البيانات المرتبطة بها لكل من مواضع أخرى معروفة، تقدم الفرصة لإجراء تقييم شامل للمساهمة وراثية من الأليلات BBS1 إلى النمط الظاهري. نحن افترض أن أدلة داعمة لمشاركة BBS1 في الميراث معقدة تشمل الملاحظات التالية. أولا، ينبغي أن المرضى الذين يعانون من الطفرات BBS1 يكون الطفرات في مواضع أخرى BBS. ثانيا، أمثلة من الأفراد غير متناظرة الذين يحملون اثنين من الطفرات BBS1 حسن النية يجب أن تكون موجودة في الأفواج لدينا. ثالثا، قد تكون مرتفعة لانتشار الطفرات BBS1 تشارك في triallelism في عموم السكان تتجاوز القيمة المتوقعة بموجب نموذج المتنحية مندلية. للحد من التهديف المحتملين والتحيز السكان لاختبار هذه التنبؤات، كل مختبر تحليل حليفها منها بشكل مستقل بطريقة ملثمين وجرى تقاسم البيانات المتراكمة إلا بعد الانتهاء من المرحلة التجريبية.
المرضى الذين يعانون من الطفرات BBS1 يكون الطفرات في مواضع أخرى BBS

عن طريق إجراء تسلسل تحليلات لجميع الجينات BBS المعروفة، وجدنا دليلا تغيري المباشر لغير مندلية الميراث سمة في ثماني أسر مع الطفرات BBS1 (13.3٪ من مجموع هذه الأسر) (الجدولين 1 و 3). من هذه العائلات، ستة (10٪ من جميع الأسر التي لديها طفرات BBS1) واثنين من الطفرات في BBS1 وطفرة واحدة في مكان آخر، وعائلتين (3.3٪ من جميع الأسر التي لديها طفرات BBS1) تقديم مزيج المتبادل. وعلاوة على ذلك، فإن نصف هذه العائلات نشأت من الفوج المملكة المتحدة والنصف الآخر من الفوج الولايات المتحدة، مما يشير إلى معدلات انتشار مماثلة من غير مندلية BBS في المجموعتين.

الجدول 3.

الأسر التي لديها طفرات في BBS1 وغيره من الامكنه
العائلة 1 2 3 النمط الفرداني Mappinga
AR69 E234K T211I (BBS7) T211I (BBS7) 4q27
AR241 M390R IVSx2 (BBS2) R315Q (BBS2) تفاصيلها
AR396 Q291X M390R S236P (BBS6) غير واضح
AR710b M390R ... 16q21
AR729b M390R ... ... ليس 11q13
AR768 M390R L548fsX579 T325P (BBS6) 11q13
PB006c M390R M390R BBS8؟ 11q13
PB009 M390R M390R L349W (BBS2) 11q13
PB029c M390R M390R BBS8؟ 11q13
PB056 M390R M390R M472V (BBS4) غير واضح


كلما أمكن ذلك، تم استبعاد الأسر من الطفرات المتنحية في مكان معين عن طريق إنشاء النسخ المتنوعة الموسعة. وتركزت هذه إما في الجين (عندما معروفة) أو علامة متعددة الأشكال وفقا لأعلى درجة اللد ومددت أبعد ذكرت أول علامة المؤتلف لكل مكان BBS.


الأسر التي لديها طفرة BBS1 واحد استبعادها من 11q13 عن طريق تحليل النمط الفرداني. في AR710 الأسرة، تحليل النمط الفرداني في جميع المعروفة BBS مواضع يتسق مع الربط BBS2، ولكن لم يتم تحديد أي طفرات. وقد تم استبعاد AR729 الأسرة من جميع المعروفة BBS مواضع.


الأسر التي يكون فيها الفرد يتأثر هو متماثل للطفرات M390R. في هذه الحالات، وافترض طفرة في رواية BBS مكان (أي BBS8؟) التي قد بذل إما سببية أو تأثير وقائي.

خيارات الجدول

في واحد نسب الإنجليزية، PB056، تتأثر كل من الأم وابنتها، الذي يشبه نمط شبه سائد من الميراث. كشف التسلسل لاحق وجود اثنين من الأليلات M390R في كل من المرضى (الشكل 2A). وعلاوة على ذلك، كل فرد المصاب لديه ثالث تغيير M472V متخالف في BBS4، الموروثة عن جده لأمه، الذي يحمل أيضا M390R أليل متخالف ولكن لا يتأثر. وعلاوة على ذلك، تم العثور على بقايا ميثيونين تشارك في M472V، على التحليل التطوري لاحقة، إلى أن الحفظ جدا (الشكل 5). لأن الأب في هذه العائلة لم يكن متوفرا، استبعدنا إمكانية M390R فردانية الزيجوت في disomy المستلفت أو أحد الأبوين (UPD) كما تفسيرات بديلة، من خلال التنميط الجيني STRPs الإقليمي وتعدد الأشكال داخل الجين (الشكل 2A).

الميراث Triallelic تنطوي BBS1. A، النسب PB56، والتي على حد سواء ...
الرقم 2.

الميراث Triallelic تنطوي BBS1. A، النسب PB56، الذي كل من الأم وابنتها تتأثر تأثرا هي M390R متماثل وأيضا يحمل طفرة M472V في BBS4. B، النسب AR396، الذي السيب المتضررين يحمل اثنين من الطفرات BBS1 (M390R وQ291X) وطفرة BBS6، S326P. C، AR241 الأسرة، الذي sibs المتضررة واثنين من الطفرات BBS2 (R315Q / R315Q؛ IVS1 + 1G) وطفرة BBS1 واحد (M390R). وتشير شرطات أن هؤلاء الأشخاص كانوا إما غير متوفرة أو غير راغبة في المشاركة في الدراسة.
خيارات الشكل

التحليل التطوري للطفرات تشارك في الميراث معقدة. ال ...
الرقم 5.

التحليل التطوري للطفرات تشارك في الميراث معقدة. تم فحص الحفاظ على كل من متحولة الأليلات BBS1، BBS2، BBS4، وBBS6 تشارك في الميراث معقدة بمقارنة تسلسل البروتين وتوقع من جميع الجينات BBS المعروفة مع orthologs وhomologs من جميع الأنواع المتاحة. ويرد أيضا في المنطقة حول كل بقايا ذات الصلة. الأزرق يمثل الهويات، والأصفر يمثل بدائل المحافظة.
خيارات الشكل

تم العثور على أمثلة من الميراث triallelic وإشراك الطفرات في اثنين مواضع متميزة أيضا في الفوج الولايات المتحدة. كان المستلفت في AR396 الأسرة متغايرة مجمع للأليل M390R وطفرة هراء Q291X وأيضا يحمل أليل S236P متخالف في BBS6 (الشكل 2B). على العكس من ذلك، بورتوريكو ذو قربى AR69 الأسرة يحمل أليل E234K متخالف في BBS1 ولكن تم استبعاد وراثيا من هذا الموضع. أثناء دراستنا، توصلنا إلى أن هذه العائلة وقد ورثت طفرة T211I متماثل في بقايا الحفظ جدا في BBS7 (Badano وآخرون 2003).

في الأسر المذكورة أعلاه، وأليل متحولة الثالث هو تغيير مغلطة. على هذا النحو، على الرغم من غيابها عن نحو 400 الكروموسومات السيطرة عرقيا المتطابقة، تبقى إمكانية أن بعض هذه الأليلات تمثل الأشكال حميدة، ونظرا لصغر حجم الأنساب، يمكن القول cosegregation هذه الأليلات مع اضطراب أن يكون من قبيل الصدفة. ومع ذلك، AR241، نسب المنحدرين من أصول أوروبية من الفوج الولايات المتحدة، ويقدم أدلة دامغة لمتطلبات الأليلات الطافرة على اثنين من مواضع. كل من الاخوة المتضررين، و-05 -06، هي متخالف لطفرة M390R BBS1. بالإضافة إلى ذلك، كل السيب يحمل أليلين BBS2 متحولة: طفرة مغلطة R315Q، وهي بقايا الأمراض المرتبطة في عائلة سعودية مع BBS، وطفرة لصق تقاطع في الموقع متقبل من اكسون 2 (Katsanis آخرون 2001a). (IVS1 + 1G → C؛ الشكل 2C). في حال من غير المحتمل أن R315Q أليل ثبت حميدة، والمرضى في هذه الأسرة لا تزال ورثت طفرات النية الحسنة في كل BBS1 وBBS2.
الأفراد غير متأثر مع اثنين من الطفرات BBS1

A التنبؤ الثاني من الفرضية triallelic هو أنه إذا الطفرات في اثنين مواضع ضرورية لالمرضية، يجب على الأفراد الذين لديهم لم يتأثر وجود اثنين من الطفرات في مكان واحد. وقد وجد هذا في السابق أن يكون صحيحا لغيرها من مواضع BBS (Katsanis آخرون 2001a؛ Katsanis وآخرون 2002)، ولكن لا BBS1 (Mykytyn وآخرون 2002). لدراسة هذا الجانب من نموذج لدينا، نحن مصممون على الفصل بين كل BBS1 أليل متحولة. على الرغم من أن في العديد من الحالات كان والدا و / أو sibs تتأثر متوفرة، يمكننا التأكد من التراكيب الوراثية لأكثر من كل فوج. وتمشيا مع وضع غير مندلية من انتقال المرض، حددنا اثنين الأنساب البريطانية (PB006 وPB029) فصل نسختين من M390R في probands، التي كان الآباء في كل حالة متماثل لطفرة BBS1 المشتركة، M390R (التين. 3A و3B). على الرغم من الحذر السريري إعادة تقييم هؤلاء الأفراد، يعرض أي من الأبوين أي ملامح النمط الظاهري BBS، وعلامة الفصل استبعاد إمكانية missampling. وهذا يطرح احتمالين: إما (1) أليل الثالث في لمكان مجهول ضروري لالمرضية في هاتين الأسرتين أو (2) أليل الثالث التي يحملها الأب ولكن ليس من قبل الأطفال يمنح حماية ضد طفرة M390R.

اثنين من الطفرات M390R ليست كافية لالمرضية. في الأنساب PB006 (A) ...
الرقم 3.

اثنين من الطفرات M390R ليست كافية لالمرضية. في الأنساب PB006 (A) وPB029 (B)، والد يتأثر هو متماثل للأليل M390R المشترك، وكذلك جميع الأشخاص المتضررين. لم يتم العثور على الطفرة الثالثة في هذه العائلتين.
خيارات الشكل

مرتفعة M390R تواتر الصبغيات في عدد السكان

A التنبؤ الثالث من نموذج السببية multilocus لBBS هو أن تردد الناقل من الطفرات تشارك في الميراث معقدة يجب أن يكون أكبر مما كان متوقعا لاضطراب المتنحية. وقد تم تقييم هذه الإمكانية من الصعب حتى الآن، لأن التردد المنخفض للBBS2 معروف، يمكن أن الطفرات BBS4، BBS6، وBBS7 في المرضى الذين يعانون من BBS يتطلب الاستعلام عن عدد كبير من الأصحاء، والأفراد غير ذات صلة. قدم وجود أليل M390R مشترك في نحو 18٪ من المرضى BBS، ومع ذلك، وإشراك هذا الأليل في عدة قضايا الميراث معقدة (الجداول 3 و 4) الفرصة لإجراء هذه الدراسة.

نحن يعاير بواسطة التسلسل 658 الكروموسومات السيطرة لا علاقة مباشرة لتغيير M390R، 75٪ منها من أصل أوروبي. اكتشفنا حاملتي متخالف، مشيرا إلى أن تردد الناقل تقريبي في البيض أوروبا وأمريكا الشمالية هو ~1: ​​325. من التحليلات طفرية لدينا، خلصنا إلى أن 10.4٪ من المرضى BBS هي متماثلة اللواقح لهذا الأليل (الجدول 4). انتشار BBS في أمريكا الشمالية وأوروبا يتراوح من 1: 100000 إلى 1: 160،000 (كلاين وآمان 1969؛ كروفت وآخرون 1995؛ Beales وآخرون 1997.). لذلك، في ظل الظروف المثالية من هاردي واينبرغ، التوازن، وتردد الناقل من M390R تحت نموذج المتنحية أن يتراوح من 1: 1000 إلى 1: 1200 الكروموسومات في عموم السكان. هذا الفرق مهم إحصائيا، لأن احتمال العثور على اثنين من الطفرات M390R في 658 الكروموسومات بالصدفة وحدها هي 2٪ فقط (اختبار دقيق ذي الحدين؛ P = 0.022). من تردد الناقل لوحظ، فإن للمرء أن يتنبأ أنه إذا أليل M390R فصل دائما مع النمط الظاهري أحادي الجين، فإن BBS يكون ~10 مرات أكثر انتشارا مما هو ملاحظ (1: 11000).

نحن تقديم تقرير عن نتائج دراسة كبيرة بين مختبرين للكشف عن الطفرات في BBS1. نحن التحقيق 259 الأنساب المنشأ متعدد الأعراق، بغض النظر عن الكشف مسبق من الطفرات في جينات أخرى. في هذه الأسر، حددنا 26 مختلفة BBS1 أليل متحولة، وهو ما يمثل 23.2٪ من الأسر في فوج لدينا جنبا إلى جنب. غلبة M390R كما الطفرة BBS1 الرئيسية لافت للنظر (موجودة في 78.3٪ من الأسر التي لديها طفرات BBS1)، مما يوحي بأن الأليل M390R قد يكون طفرة القديمة، وخاصة منذ الطفرة ليست نتيجة لثنائي النوكليوتيد الانتقال الدليل السياسي الشامل. وعلاوة على ذلك، التحليل الجيني عبر موضع BBS1 يشير إلى وجود النمط الفرداني مشترك لجميع أرجينين التي تحمل 390 الكروموسومات (Mykytyn وآخرون 2003؛. بيانات غير منشورة المؤلفين). قد تعكس هذه ميزة انتقائية إيجابية لالزيجوت M390R أو الانجراف الوراثي. والجدير بالذكر أن وجدنا أليل أرجينين 390 بشكل حصري تقريبا في الأسر المنحدرة من أصول أوروبية، مما يشير إلى هذا الأليل قد تم إصلاحها في هذه الفئة من السكان.
دليل على أن BBS1 تشارك في Triallelic الوراثة

تحليلاتنا توفر ثلاثة خطوط مستقلة أدلة داعمة لفرضية أن تشارك BBS1 في الميراث triallelic. أولا، حددنا عدة عائلات BBS1 التي تفصل ما مجموعه ثلاثة أليل متحولة. في بعض الحالات، واثنين من الأليلات BBS1 cosegregate مع BBS2 واحد، BBS4، أو BBS6 أليل، بينما في حالات أخرى، فإن الطفرة BBS1 واحدة موجودة في المرضى، جنبا إلى جنب مع اثنين من الطفرات في BBS2 أو BBS7 (Badano وآخرون 2003 ). ونظرا لندرة من متلازمة وانخفاض مساهمة BBS2 المسببة للأمراض، الأليلات BBS4، BBS6، وBBS7 إلى BBS، واحتمال أن هؤلاء المرضى يحملون قبيل الصدفة من الطفرات في أكثر من واحد الجينات BBS لا يكاد يذكر (Katsanis آخرون 2001a). ثانيا، توصلنا إلى أن، في عائلتين لا علاقة لها، كان الأب في كل حالة لم يتأثر ومتماثل للأليل M390R المشترك، مشيرا إلى أن اثنين من الطفرات BBS1 ليست دائما كافية لالمرضية. وأخيرا، توصلنا إلى أن وتيرة الناقل للأليل M390R في عموم السكان لا يتفق مع وضع مقهورة حصرا من الميراث. الفرق 10 أضعاف بين التردد وتوقع وتصميما تجريبيا من BBS في الشعوب الأوروبية يصعب تفسيره على أنه مجرد نتيجة لتحيز التشخيص أو التحديد. وهناك تفسير أكثر احتمالا هو أن أليل M390R ليس دائما توغل بشكل كامل. نقترح أن وضع قليل الجينات الميراث في BBS قد تكون مسؤولة عن بعض nonpenetrance من M390R. وتمشيا مع هذه الفرضية، فقد قررنا أن 15٪ من الأسر التي لديها طفرات BBS1 التي تحمل واحدة على الأقل M390R أليل يحمل غير مندلية سمة الميراث (الجداول 3 و 4). نقترح أيضا أن nonpenetrance من M390R قد تنبع من متطلبات إما أليل الإمراض الثالث في المرضى أو أليل واقية الثالث في الأفراد تتأثر. منذ إضافي BBS مواضع من المحتمل أن تكون موجودة في الجينوم (> 50٪ من الأنساب لدينا تتحمل أي طفرات في الجينات الخمسة المعروفة واختبارها، ومعظم يمكن استبعاد بواسطة الربط من BBS3 وBBS5، وهما ما تبقى من مواضع معين)، وهذه الفرضيات البديلة لا يمكن بعد تقييمها بشكل كامل.

خلصت دراسة حديثة إلى أن BBS1 لا يحمل الإرث المعقدة القائمة على تحليل 43 probands لا علاقة لها مع اثنين من الطفرات BBS1 من لفيف من 129 عائلة مع BBS (Mykytyn وآخرون 2003). بياناتنا تتفق مع هذه الملاحظات في هذا BBS1 لا يبدو أن تشارك عادة في الميراث معقدة مع مواضع أخرى معروفة. وعلى النقيض من استنتاجات Mykytyn والزملاء، ومع ذلك، ونحن التقرير العديد من الأمثلة التي الطفرات في BBS1 وحدها غير كافية لالمرضية. قد يكون راجعا إلى الاختلاف في الحجم النسبي للفوج في كل دراسة هذا التباين. وعلاوة على ذلك، فوج لدينا هو على الأرجح أكثر تنوعا وراثيا، حيث أن حسابات أليل M390R 18٪ من الطفرات في مجموعتنا (مقابل> 30٪ في الدراسة التي Mykytyn وآخرون)، وبالتالي زيادة احتمال الكشف عن مجموعات أليل أكثر ندرة. نلاحظ أيضا، مع ذلك، أن بعض الجوانب التحليلية قدمت من قبل Mykytyn وآخرون. (2003) هي، بداهة، والتي تتنافى مع اختبار فرضية الميراث معقدة. أولا، تقييم الإرث المعقد في الأسر المستخدمة لتحديد وجود مكان BBS بواسطة الربط التقليدي من غير المرجح أن تقدم معلومات مفيدة، حيث إن وجود الإرث المعقد قد يكون الربط بعدم جواز في المقام الأول. ثانيا، الفحص التقليدي للصبغيات تحكم وحدها توجد أدلة كافية لتحديد تأثير العدوى من أي أليل معين، حيث من المتوقع أن يكون تردد الناقل مرتفعة في عموم السكان الطفرات المشاركة في الميراث معقدة. وأخيرا، نلاحظ باهتمام أن Mykytyn وآخرون. ذكرت عائلتين مع طفرة BBS1 واحدة مع عدم وجود دليل على وجود أليل BBS1 الثاني. الأهم من ذلك، أنهم تقرير الأليلات مغلطة في غيرها من مواضع BBS، التي لا تمثل بدائل المحافظة ولا تم العثور عليها في الكروموسومات السيطرة ولكن قد لا عزل المصابين بهذا الاضطراب. لقد وجدنا اثنين من الحالات التي أليل متحولة الثالث يمارس تأثير التعديل على النمط الظاهري وأظهرت النمط الظاهري الخلوية لمثل "nonsegregating" أليل الثالثة (بيانات غير منشورة المؤلفين). ولذا فإننا نقترح أن بعض الطفرات التي أعلن عنها في الجدول 2 من تقرير صدر مؤخرا عن Mykytyn وآخرون. قد لا تكون هذه الأشكال ولكن الطفرات المسببة للأمراض حميدة.
انتشار وتوزيع Triallelic الميراث في BBS

من وجهة نظرنا الطفرات، وراثية، والبيانات السكانية، فإننا نستنتج أن BBS1، مثل غيرها من BBS مواضع معروفة، وتشارك في كل جسمي الميراث المتنحية وقليل الجينات. ومع ذلك، خلافا لبعض مواضع BBS الآخرين، والغالبية العظمى من الطفرات BBS1 يبدو أن فصل بطريقة مقهورة. عموما، في نحو 75٪ من الأسر التي لديها طفرات BBS1، أليلين تظهر كافية لإمراض (الجدول 1). وبمقارنة هذه البيانات مع مواضع BBS آخر يشير إلى أن كل الجينات لديها مستوى متميز في تورطهم في triallelism (الشكل 4A). على الرغم من أن أعداد الأسر التي لديها طفرات المعقدة في BBS4 وBBS7 صغيرة جدا لمقارنة دقيقة، على ما يبدو، على أساس البيانات المحدودة المتاحة في الوقت الحاضر، أن الطفرات في BBS2 وBBS6 هي الأكثر كافية في كثير من الأحيان أن تسبب المرض في حد ذاتها. في تركيبات triallelic تحديدها حتى الآن، BBS6 يساهم أليل متحولة واحد ثلاث مرات بقدر ما BBS2 وضعفي ما BBS4 (الشكل 4A). ليس من المستغرب، والأكثر شيوعا BBS الاقتران الجين هو بين BBS2 وBBS6 (الشكل 4B)، على الرغم من أن يدعم هذه الملاحظة فقط كما يتم استنساخ الجينات BBS إضافية ويتم التأكد مجموعات تحور أكثر triallelic.


رافت ابراهيم 11-23-2015 07:57 PM

بارديه-بيدل نوع متلازمة 4 (BBS4) الفئران -null توريط Bbs4 في تشكيل سياط ولكن ليس التجمع أهداب العالمي

وظائف البروتينات المشفرة بواسطة متلازمة بارديه-بيدل (BBS) جينات غير معروفة. الطفرات في هذه الجينات تؤدي إلى اضطراب البشري عديد المظاهر BBS، التي تتميز البدانة، اعتلال الشبكية، polydactyly، الكلى وتشوهات القلب، وصعوبات التعلم، ونقص الأعضاء التناسلية. وتشمل الميزات الثانوية داء السكري وارتفاع ضغط الدم. في الآونة الأخيرة، وقد اقترح أن الظواهر BBS هي نتيجة لعدم تشكيل أهداب أو وظيفة. في هذه الدراسة، وتبين لنا أن الفئران التي تفتقر إلى البروتين Bbs4 على مكونات رئيسية من النمط الظاهري الإنسان، بما في ذلك السمنة وتنكس الشبكية. وتبين لنا أن الفئران Bbs4 فارغة تطوير كل من أهداب متحركة والابتدائي، مما يدل على أن Bbs4 غير مطلوب لتشكيل أهداب العالمي. ومن المثير للاهتمام، الفئران Bbs4 فارغة الذكور لا تشكل الحيوانات المنوية سياط، وBBS4 اعتلال الشبكية ينطوي الموت أفكارك من المستقبلات الضوئية، والخلايا المهدبة الابتدائية من شبكية العين. تدل هذه البيانات على طفرة اتصال بين وظيفة بروتين BBS وأهداب. لمزيد من تقييم وجود ارتباط بين أهداب وBBS، أجرينا مقارنات تناظر من البروتينات BBS في الكائنات نموذج وجدت أن البروتينات BBS يتم حفظها على وجه التحديد في الكائنات المهدبة.
متلازمة بارديه-بيدل (BBS) هو اضطراب غير المتجانسة وراثيا مع الربط إلى ثمانية مواضع. وقد تم تحديد ستة جينات BBS (BBS1، BBS2، BBS4، BBS6، BBS7، وBBS8) (1 - 7). باستثناء BBS6، التي لديها تشابه لكتابة II chaperonins (8)، والبروتينات BBS لا تظهر التماثل واسعة مع البروتينات وظيفة معروفة. BBS4 وBBS8 يحتوي على تكرار المجالات tetratricopeptide، ومنطقة BBS8 تبين التشابه إلى المجال pilF بدائيات النواة. استنادا إلى الملاحظات التي BBS8 يموضع إلى الجسم القاعدية من الخلايا المهدبة والتعبير عن انواع معينة ايليجانس orthologues من عدة بروتينات BBS تقتصر على الخلايا المهدبة، فقد تم الافتراض أن BBS هو نتيجة لخلل في التجمع أهداب أو وظيفة (7 ). كنا سابقا الاستنساخ الموضعية لتحديد الجين BBS4 الإنسان (3). للمساعدة في توضيح وظيفة البروتينات BBS، استهدفنا الآن الجين Bbs4 في الفئران Bbs4 - / - الفئران ألخص جوانب النمط الظاهري البشري: أن تصبح السمنة، تفشل في إعادة إنتاج، وعرض تنكس الشبكية. وتبين لنا وجود كل من أهداب متحركة والأساسي في هذه الفئران، مما يدل على أن نقص Bbs4 لا يمنع تكون الأهداب العالمي. ومن المثير للاهتمام، الفئران خروج المغلوب من الذكور لديهم انعدام تام للسياط، مما يدل على أن البروتين Bbs4 ضروري لتشكيل سياط خلال تكوين الحيوانات المنوية. وعلاوة على ذلك، الفئران Bbs4 فارغة تخضع تنكس الشبكية يرجع أساسا إلى فقدان خلايا مستقبلة للضوء المرتبطة توهين الجزء الخارجي، مما يشير إلى دور البروتينات BBS في الحفاظ على أهداب الحسية. تدل هذه البيانات على دور للبروتينات BBS في جوانب وظيفة الأهداب.
المواد والأساليب

بناء على تحليل الانفجار Bbs4 جين استهداف ناقلات. من سيليرا قاعدة بيانات الماوس جزء مع تسلسل تحديد تسلسل BBS4 كدنا] الإنسان الموافق الماوس الإكسونات Bbs4. شيد بديلا Bbs4 ناقلات في خطوتين الاستنساخ. ل 'تناظر 5، وsubcloned 3-KB PCR جزء يحتوي على تسلسل الحمض النووي الجيني الموافق الإكسونات 3-5 في مواقع NHE الأول وXho الأول من pOSdupdel (هدية من O. سميثيز، جامعة نورث كارولاينا في تشابل هيل ). ل 'التماثل 3، وsubcloned 3.8 كيلوبايت PCR جزء يحتوي على الإكسونات 12-15 في سال الأول وليس المواقع I.
جيل من Bbs4 - / - الفئران وخطي وبناء الاستهداف في غير الموقع الذي فريدة من نوعها و electroporated إلى R1 الجذعية الجنينية (ES) خلايا (129 × 1 / SvJ3129S1 / سيفرت). وقد تم اختيار الخلايا ES في G418 وGanciclovir، وجرى توسيع المستعمرات الباقين على قيد الحياة في لوحات 96-جيدا لفرزها. تم عزل الجينوم DNA من خلايا ES التي يحتضنها في 50 ميكرولتر من تحلل العازلة (50 ملي تريس · حمض الهيدروكلوريك، ودرجة الحموضة 8.5 / 2.5 ملي EDTA / 100 ملي كلوريد الصوديوم / 0.1٪ SDS / 500 ميكروغرام / مل بروتين K) لمدة 12-24 ساعة عند 55 ° C. بعد الحضانة، والمخفف لست] الخلية إلى 500 μlofddH 2 O، واستخدمت قسامات 2-ميكرولتر كقوالب لPCR التضخيم. الاشعال محددة ل 'أليل خروج المغلوب (إلى الأمام، 5'-CGTGTACCCACACATGGGGAGCCA-3' 5؛ عكس، 5'-CCGGAGAACCTGCGTGCAATCCAT-3 ') و 3' خروج المغلوب أليل (إلى الأمام، 5'-GGGCTGACCGCTTCCTCGTGCTTT-3 '؛ عكس، 5'- استخدمت TGCACCCAGGAGGGATGCCCATAA-3 ') في إتمام المشروعات طويلة المدى لتحديد الأحداث استهداف الصحيحة. تم تنفيذ PCR في التفاعلات 25 ميكرولتر تحتوي على 5 ميكرولتر من 5 × PCR العازلة [300 ملي تريس · SO 4، ودرجة الحموضة 9.1 / 90 ملم (NH 4) 2 SO 4/10 ملي MgSO 4]، 250 ميكرومتر كل من dATP، dCTP ، dGTP، وdTTP، 2.5 بمول من كل التمهيدي، و1 وحدة من Elongase (إينفيتروجن). تعرض عينات إلى 35 دورات من 94 درجة مئوية لمدة 30 ثانية و 68 درجة مئوية لمدة 6 دقائق. وتصور منتجات التضخيم على هلام الاغاروز 0.8٪. تم حقن خلايا ES متخالف لBbs4 أليل متحولة إلى C57BL / 6J الكيسات الأريمية. تم حقن اثنين من الحيوانات المستنسخة المستهدفة في الكيسات الأريمية، وكلا الوهم المنتجة. استخدمت حيوانات خيالية لتوليد Bbs4 متخالف (Bbs4 +/-) الفئران على خلفية وراثية مختلطة من قبل التزاوج مع C57BL / 6J الفئران. تم backcrossed الفئران على خلفية وراثية مختلطة لجيلين على الأقل لإثراء لC57BL / 6J الخلفية. تم intercrossed الفئران متخالف، وكان التنميط الجيني لسلالة بواسطة PCR باستخدام بادئات المشار إليها أعلاه لتحديد وجود أليل المستهدفة. تم تحديد وجود من النوع البري أليل باستخدام بادئات محددة ل5 'من النوع البري أليل (إلى الأمام، 5'-CGTGTACCCACACATGGGGAGCCA-3'؛ عكس، 5'-GGATCCGCAGGCCATGTGCTCAAA-3 ') و 3' من النوع البري أليل ( إلى الأمام، 5'-CACCGGACCTTCCAGACCGACCTC-3 '؛ عكس، 5'-TGCACCCAGGAGGGATGCCCATAA-3). شروط PCR وكما هو موضح أعلاه.
عزل الحمض النووي الريبي والشمالية وصمة عار التحليل. الأنسجة من إناث الفئران القديمة 8 أشهر تم تجميد بسرعة في النيتروجين السائل وتخزينه في -80 درجة مئوية حتى الاستخدام. أجريت مجموع استخراج الحمض النووي الريبي الخلوية، هلام الكهربائي، النشاف والتهجين، وتصوير الإشعاع الذاتي خارج كما هو موضح (9). تم إنشاؤها الماوس Bbs4 كدنا] التحقيق باستخدام بادئات محددة ل 'UTR (إلى الأمام، 5'-CCATAACCTGGGAGTGTGCT-3 "3، عكس، 5'-AGCAGATTTGCTGCCTGAAT-3). تم تجريد لطخة من النشاط الإشعاعي وrehybridized مع لجنة التحقيق [كدنا لβ -actin للتحقق من التحميل على قدم المساواة من الحمض النووي الريبي.
النسيجية، Immunohistological، ومحطة Deoxynucleotidyltransferase بوساطة dUTP نيك نهاية وصفها (النفق) التحليل بعد الموت، ومنزوعة النواة عيون وثابتة عن طريق الغمر في محلول 4٪ لامتصاص العرق في 100 ملي العازلة كاكوديلات، ودرجة الحموضة 7.4. بعد 2-4 ساعة من التثبيت، وكانت تغسل العيون ثلاث مرات في 10 ملي PBS تليها تسلل والغرز في مادة الأكريلاميد، كما هو موضح (10). عندما يكون ذلك ممكنا، وتوجه الكتل بحيث أقسام السهمي تضمنت محاور الأعلى والأدنى. تم جمع المقاطع ناظم البرد في سمك 5-7 ميكرون، وتخزينها في 4 درجات مئوية حتى الاستخدام. تم عزل الخصيتين وثابتة في بارافورمالدهيد 4٪ في برنامج تلفزيوني بين عشية وضحاها. وكان الأنسجة ثم منعت في البارافين ومقطوع عن الهيماتوكسيلين / يوزين تلطيخ. تم إجراء وسم خلايا مستقبلة للضوء قضيب مع RET-P1 حيدة النسيلة الأجسام المضادة (سانتا كروز التكنولوجيا الحيوية) في 1: 1000 التخفيف، تليها التصور مع الأجسام المضادة اليكسا-488-مترافق الموجهة ضد مفتش الماوس (المسابر الجزيئية). لTUNEL تلطيخ، وفي الموقع موت الخلية عدة كشفها، TMR الأحمر (روش العلوم التطبيقية)، واستخدمت وفقا لتعليمات الشركة الصانعة. تم counterstained النوى مع 4، 6-diamidino-2-phenylindole (دابي؛ المسابر الجزيئية). كان ينظر المقاطع على أوليمبوس BX-51 المجهر وتم جمع الصور مع SPOT RT كاميرا رقمية (أدوات التشخيص).
الإلكترون التحليل المجهري القصبة الهوائية من Bbs4 - / - تم إصلاح الحيوانات في نصف القوة تثبيتي Karnovsky في (11) لعدة ساعات قبل postfixation الأوسيميوم، والجفاف، وتضمينها في الإي بي شوهدت 812. أقسام سامسونج في المجهر الإلكتروني النافذ، وكانت الصور التي اتخذت في × 35000 و× 2500 من خلال أهداب. الخصيتين من Bbs4 + / + وBbs4 - / - كانت جزءا لا يتجزأ الحيوانات في الراتنج سبر وملطخة 1٪ طولويدين الأزرق. الكلى من Bbs4 + / + وBbs4 - / - كانت الحيوانات المجففة في الإيثانول وجفت باستخدام جفافا نقطة حرجة. وكانت العينات ثم استوى على كعب الألومنيوم باستخدام المزدوج عصا الشريط الكربون، المغلفة مع الذهب / البلاديوم باستخدام المغطي تفل، ثم درست على فيليبس XL 30 مجهر المسح الإلكتروني.


Bbs4 استهداف. استهدفنا الجينات Bbs4 في الفئران عن طريق بناء ناقلات تحتوي على مناطق الماوس Bbs4 الجين الذي، على إعادة التركيب مثلي، محل الإكسونات 11/06 مع كاسيت بالنيوميسين (الشكل 1 A). هذا الحدث يزيل ما يقرب من ثلث تسلسل Bbs4 الترميز، مما أدى إلى انزياح الإطار المتوقع أن تخلق أليل فارغة. تم إجراء تحليل لطخة الشمالية باستخدام الحمض النووي الريبي معزولة عن Bbs4 + / +، Bbs4 +/-، وBbs4 - / - الفئران للتأكد من أن استهداف الجينات أدى إلى أليل فارغة (الشكل 1 B.). أدى التنميط الجيني ليترات من intercrosses Bbs4 +/- في F 2 نسب لBbs4 + / + / Bbs4 +/- / Bbs4 - / - الحيوانات 0.36: 0.51: 0.13، مختلفة كثيرا عن المتوقع 0.25: 0.5: 0.25 نسب المندلية ( χ 2 = 7.21، P <0.05).
تين. 1.
استهداف الجين Bbs4. (A) رسم تخطيطي لBbs4 استهداف ناقلات والمنتج إعادة التركيب الناتجة عن ذلك. على إعادة التركيب المتماثل، يتم استبدال الإكسونات 11/06 مع كاسيت بالنيوميسين. (B) (العلوي) تحليل لطخة الشمالي من Bbs4 التعبير في الكلى مجموع RNA الخلوية من النوع البري (+ / +)، متخالف (+/-)، ومتماثل (- / -) الحيوانات. التحقيق هو 960-BP Bbs4 الجزئي 3 'كدنا]. (السفلى) نفس طخة بحث مع β -actin كعنصر تحكم التحميل.

الفئران Bbs4 خالية سمنة Bbs4 - / - يبدو أن الفئران إلى أن تكون صغيرة عند الولادة، تزن أقل من تتزاحم بهم في 3 أسابيع من العمر، وسمنة على مر الزمن (الشكل 2 A - C). بعد الفطام، Bbs4 - / - الفئران تبدأ في كسب المزيد من الوزن من النوع البري الفئران، المتزامنة مع قدر أكبر من الاستهلاك الغذائي (لا تظهر البيانات). قبل 12 أسبوعا من العمر، الفئران Bbs4 فارغة تزن أكثر بكثير من تتزاحم سيطرتهم. الفرق بين الوزن الحيوانات Bbs4 فارغة والضوابط يصبح أكبر في الحيوانات الأكبر سنا، وشهدت زيادة الوزن مماثل لكل من الذكور وإناث الحيوانات. النظر في توزيع الدهون في الحيوانات الأكبر سنا يدل على أن زيادة الوزن يتوافق مع زيادة في الأنسجة الدهنية المودعة مركزيا (الشكل 2 D).
تين. 2.
المقارنة بين الوزن وترسيب الأنسجة الدهنية في الفئران Bbs4. (A) ووزن كل من النوع البري (Bbs4 + / ن = 40)، متخالف (Bbs4 +/-، ن = 40)، ومتماثل (Bbs4 - / ن = 36) الفئران في 3 و 8 ، 12، 16، 20، و 24 أسابيع من العمر. يتم التعبير عن القيم كما يعني ± SEM. (B) وأوزان الذكور من النوع البري (Bbs4 + / ن = 20)، متخالف (Bbs4 +/-، ن = 20)، ومتماثل (Bbs4 - / ن = 20) الفئران. يتم التعبير عن القيم كما يعني ± SEM. (C) وأوزان الإناث البرية من نوع (Bbs4 + / ن = 20)، متخالف (Bbs4 +/-، ن = 20)، ومتماثل (Bbs4 - / ن = 16) الفئران. يتم التعبير عن القيم كما يعني ± SEM. (D) فحص ترسيب الأنسجة الدهنية يوضح زيادة في كمية الأنسجة الدهنية المركزية في Bbs4 - / - الماوس (يمين)، بالمقارنة مع Bbs4 + / + ماوس (يسار). الفئران من الذكور القديمة ≈10 شهرا.

. الفئران Bbs4 خالية الخضوع أفكارك الشبكية البقعي واعتلال الشبكية هو الميزة الأساسية في BBS، درسنا شبكية العين من Bbs4 - / - الفئران Bbs4 - / - الفئران من تتراوح أعمارهم بين 7 أشهر أو المعرض الأكبر سنا غياب كامل للخلايا مستقبلة للضوء وفقا لتقييم عدم وجود طبقة النووية الخارجي وعدم وجود مبصرة قطاعات الداخلية والخارجية (الشكل 3 A - D). شبكية العين الداخلية من هذه الحيوانات على ما يبدو سليمة مع الداخلية طبقات الخلايا النووية والعقدية العادية.
تين. 3.
فحص شبكية العين الماوس. (A و B) الهيماتوكسيلين ويوزين تلطيخ أقسام شبكية العين من Bbs4 + / + (A) وBbs4 - / - (B) الماوس. طبقة مبصرة كلها غائبة في Bbs4 - قسم - /. CH، choroids. RPE، في شبكية العين الظهارة الصبغية. OS، الجزء الخارجي؛ ONL، طبقة النووية الخارجي؛ INL، طبقة النووية الداخلية. GCL، طبقة الخلايا العقدية. (C و D) وصفها من قضبان مع مكافحة أوبسين (الأخضر) من Bbs4 + / + (C) وBbs4 - / - (D) الماوس. عدم وجود العلامات في Bbs4 - / - يؤكد قسم الشبكية غياب المستقبلات الضوئية. (E و F) وسمها قضبان مع مكافحة أوبسين (الأخضر) من Bbs4 + / + (E) وBbs4 عمره 6 أسابيع - / - (F) الماوس، مما يدل على وجود خلايا مستقبلة للضوء. طبقات النووية ومستقبلة للضوء الخارجي في Bbs4 - / - القسم ما يقرب من نصف سمك Bbs4 + / + قسم، مشيرا إلى انحطاط كبير خلية مستقبلة للضوء.

لتحديد ما إذا كان غياب المستقبلات الضوئية في الحيوانات الأكبر سنا هو نتيجة تنكس الشبكية أو يمثل الخلل التنموي، قمنا بتقييم عيون من الحيوانات الصغيرة. Bbs4 القديمة اسبوعين - / - يبدو أن الفئران أن يكون شبكية العين العادية. ومع ذلك، في 6 أسابيع من العمر، Bbs4 - / - أظهرت الفئران توهين الجزء الخارجي مبصرة وطبقة النووية الخارجي هو واحد نصف سمك أن الحيوانات التحكم (الشكل 3 E و F.). قبل ستة أسابيع من العمر، لوحظ حدوث مخطط كهربية غير طبيعية، مما يدل على وظيفة الشبكية غير طبيعية. في المرضى الذين يعانون BBS الإنسان، وتنكس الشبكية هو التدريجي بالمثل مع فقدان حدة البصر عادة ما تبدأ قبل 10 عاما من العمر، ومما أدى إلى العمى القانوني 20 سنة من العمر.
درسنا آلية موت الخلايا المستقبلة للضوء في Bbs4 عمرها 6 أسابيع - / - الفئران باستخدام تحليل النفق. الحيوانات السيطرة تمتلك نوى-TUNEL إيجابي نادرة للغاية في شبكية العين، وعلى النقيض من Bbs4 - / - الفئران، والتي تظهر نواة المسمى متعددة لكل قسم (لا تظهر البيانات). لم تراع نوى TUNEL إيجابية في طبقات الخلايا النووية والعقدة الداخلية، مشيرا إلى أنه ليس هناك سوى طبقة النووية الخارجي يتأثر. وتبين هذه النتائج أن Bbs4 - / - الفئران تخضع تنكس الشبكية من خلال آلية أفكارك التي تستهدف على وجه التحديد خلايا مستقبلة للضوء وينطوي على توهين مبصرة قطاعات الخارجي.
. ذكور الفئران Bbs4 خالية لا تتطور سياط لاحظنا أن Bbs4 - / - فشلت الذكور لنجب ذرية. للتحقيق في العقم عند الذكور، درسنا الأنابيب المنوية من Bbs4 - / - الفئران بما في ذلك الشباب الحيوانات الناضجة جنسيا وكذلك الحيوانات الأكبر سنا. في Bbs4 + / حيوانات، لوحظت الحيوانات المنوية مع التشكل الطبيعي في جميع الحيوانات فحصها كما يتضح من وجود سياط ونوى الحيوانات المنوية مكثف (+ الشكل 4 A و C). ومع ذلك، في Bbs4 - / - الذكور، هناك انعدام تام للسياط (الشكل 4 B.، حتى في الخلايا مع رئيس المكثف الحيوانات المنوية وجسيم طرفي) (الشكل 4 D.). عدم القدرة على الكشف عن أي الأسواط في الأنابيب المنوية من الذكور Bbs4 - / - الفئران من مختلف الأعمار، على الرغم من الأدلة تطوير الحيوانات المنوية، يشير إلى أن سياط لا تشكيلها.
تين. 4.
الفحص النسيجي من الماوس الأنابيب المنوية. (A) الهيماتوكسيلين ويوزين تلطيخ قسم الخصيتين من Bbs4 + / + الماوس. سياط واضحة في تجويف أنبوب صغير. (B) الهيماتوكسيلين ويوزين تلطيخ قسم الخصيتين من Bbs4 - / - الماوس يظهر غياب الأسواط في التجويف. (C) طولويدين تلطيخ الأزرق من قسم الخصيتين 1 ميكرون من Bbs4 + / + الماوس تظهر الحيوانات المنوية مع التشكل الطبيعي كما يتضح من وجود سياط ونوى الحيوانات المنوية المختصرة. (D) طولويدين تلطيخ الأزرق من قسم الخصيتين 1 ميكرون من Bbs4 - / - الماوس تبين وجود نواة الحيوان المنوي المختصرة في سياط الغياب.

عدم وجود Bbs4 لا يمنع متحركة أو الابتدائية سيليا تشكيل. ونظرا لتوهين الملحوظ من مبصرة قطاعات الخارجية، وغياب الحيوانات المنوية سياط، وذكرت مؤخرا أدلة على أن بعض البروتينات BBS توطين للهيئات القاعدية، كنا المجهر الإلكتروني لدراسة هيكل كلا متحركة وأهداب الابتدائي في Bbs4 - / - الفئران. تم استخدام المجهر انتقال الإلكترون إلى دراسة هيكل أهداب متحركة من القصبة الهوائية من Bbs4 - / - الفئران. وقد لوحظ هيكل الخيط المحوري العادي مع المقابلة الترتيب 9 + 2 أنيبيب في Bbs4 - / - الفئران (الشكل 5 A). لتقييم بنية أهداب الابتدائي، أجرينا المسح المجهر الإلكتروني على الخلايا الظهارية في الكلى. وقد لوحظ وجود أهداب الرئيسي الممتد من سطح الخلايا أنبوبي كلوي في Bbs4 + / + (الشكل 5 B. وBbs4، السهام) - / - (الشكل 5 السهام) الحيوانات. ولذلك، Bbs4 - / - الفئران تمتلك الأهداب كلا متحركة والأساسي الذي يبدو طبيعيا بشكل صارخ في الطول، عدد، والهيكل.
تين. 5.
الإلكترون التحليل المجهري للأهداب متحركة والابتدائي. (A) نقل الإلكترون صورة مجهرية لشريحة من أهداب في القصبة الهوائية لBbs4 - / - الماوس. تم تعريفها بوضوح تسعة الخارجي واثنين من الأنابيب الدقيقة الداخلية، مشيرا إلى أن البنية الداخلية للأهداب متحركة يبدو طبيعيا. (B و C) الضوئي الإلكترون صورة مجهرية من خلايا النبيبات الكلوية من Bbs4 + / + (B) وBbs4 - / - (C) الماوس. طبيعي الظهور أهداب الابتدائي (السهام) جلية في كل منهما.

حفظ النشوء والتطور من BBS البروتينات. لتحديد ما إذا كانت البيانات النشوء والتطور تدعم دور البروتينات BBS في وظيفة الأهداب، أجرينا تحليل انفجار BBS4 وغيرها من البروتينات BBS المعروفة ضد المتاحة قواعد البيانات تسلسل الجينوم من EnsEMBL (المصحف العضلة، دانيو rerio، ذبابة الفاكهة، وانواع معينة ايليجانس)، JGI (Ciona المعوية وكلاميدوموناس reinhardtii)، TIGR (المثقبيات البروسية والمثقبيات الكروزية)، SGD (خميرة الخباز)، سانجر (السكيراء pombe)، واسع (الرشاشيات nidulans)، وTAIR (نبات الأرابيدوبسيس thaliana). تم تقييم الكائنات التي تم تحديدها المتماثلات BBS المفترضة مزيدا من التحليل الانفجار ضد البروتينات المتوقعة لتلك الكائنات. وكان من النتائج إثارة للدهشة هو أنه، بصفة عامة، والكائنات المهدبة لها تسلسل المتجانسة للغاية لبروتينات BBS، في حين أن الكائنات nonciliated لا (الجدول 1). على سبيل المثال، وحيدة الخلية المهدبة حتى أقل الكائنات مثل T. البروسية، T. الكروزية، وC. reinhardtii يكون تسلسل المتجانسة للغاية لبروتينات BBS المعروفة. بالإضافة إلى ذلك، اللافقاريات مهدبة، Ciona المعوية، لديه تسلسل المتجانسة للغاية لبروتينات BBS. في المقابل، الكائنات بدون أهداب (أي، S. الخباز، السكيراء pombe، الرشاشية المعششة، وA. thaliana) لا تملك متواليات التي هي غاية مثلي لBBS تسلسل البروتين. ومن المثير للاهتمام، D. البطن له المتماثلات فقط لBBS1، BBS4، وBBS8. الاستثناء الملحوظ في حفظ العام للبروتينات BBS في الكائنات المهدبة هو BBS6، التي ليس لها إلا التماثل على مستوى منخفض في معظم الكائنات الحية nonvertebrate تقييمها.

الجدول 1. الشخصي النشوء والتطور من BBS homologies البروتين في جينومات مختلفة تظهر القيم المتوقعة الحصول عليها من تحليل الانفجار من البروتينات BBS الإنسان ضد قواعد البيانات البروتين وتوقع مجموعة من مهدب (MM، DR، CI، CE، CR، TC، السل، DM) و nonciliated (SC، SP، AN، AT) الكائنات الحية


وتساهم هذه النتائج الموضحة هنا في فهمنا لوظيفة البروتين BBS4. وتبين لنا أن الفئران التي تفتقر Bbs4 تطوير والسمنة، وعرض تنكس الشبكية، وتفشل في تجميع سياط خلال تكوين الحيوانات المنوية. بناء على توطين بعض البروتينات BBS على الجسم القاعدية من الخلايا المهدبة (7)، يمكن من حيث المبدأ أن تشارك البروتينات BBS في تكون الأهداب، صيانة أهداب والنقل intraflagellar (IFT)، و / أو أنيبيب النقل داخل الخلايا التابعة. نتائجنا تظهر ان غياب البروتين Bbs4 لا يمنع التشكيل الأولي إما أهداب متحركة أو الأساسي، على الرغم من عدم وجود هذا البروتين لا يؤدي إلى فشل تشكيل الأسواط في الحيوانات المنوية الناضجة. هذه النتائج تشير إلى أن هناك اختلافات في متطلبات Bbs4 بين التجمع من الأسواط والأهداب. وقد تبين أن بعض مكونات IFT مطلوبة للأهداب والتجمع سياط (12). ومع ذلك، كما تم الإبلاغ عن بعض الاختلافات في هذه العمليات. على سبيل المثال، وقد تجلى ذلك في ذبابة الفاكهة ما هو مطلوب IFT للتمييز أهداب الحسية، ولكن ليس الحيوانات المنوية (13). مزيد من الدراسة سوف تكون ضرورية لتحديد ما إذا كانت وظائف بروتينات BBS تقتصر على مجموعة فرعية من الأهداب.
وقد أشير إلى أن البروتينات BBS من غير المرجح أن تلعب دورا في IFT لأنهم لا توطين للالخيط المحوري (7). ومع ذلك، وهذه البيانات توطين تتسق مع إمكانية أن البروتينات BBS بمثابة وسطاء للاتصال و / أو نقل الخلايا بين هدب والداخلية للخلية. بدلا من لعب دور مباشر في IFT، قد البروتينات BBS تلعب دور مساعد عن طريق إعداد جزيئات للنقل، أو من خلال لعب دور في النقل داخل الخلايا المرتبطة أنيبيب.
A خلل في IFT يتسق مع تنكس الشبكية التي ينظر اليها في Bbs4 - / - الفئران. ويعتقد أن هدب يربط بين الجزء الداخلي والخارجي للشبكية لتكون الطريق الحصري لنقل البروتينات تصنيعه حديثا من الداخلية إلى الجزء الخارجي. وقد تبين أن تعطل هذه العملية في كينيسين-II نموذج الماوس خروج المغلوب الشرطي أن يسبب تنكس الشبكية، مما يدل على أن IFT هو مطلوب للحفاظ على الجزء الخارجي من خلايا مستقبلة للضوء (14). وتبين لنا أن فقدان Bbs4 لا يمنع التشكيل الأولي للقطاعات مبصرة الخارجي، ونقترح أن غيابها يؤثر سلبا على النقل بين الخلايا ما هو مطلوب للحفاظ على تجديد بسرعة قطاعات الخارجي من هذه الخلايا. فشل تشكيل سياط ومبصرة صيانة الجزء الخارجي في Bbs4 - / - الحيوانات توفر البيانات طفرية الأولى مباشرة مما يدل على دور الهدبية للبروتينات BBS.
بالإضافة إلى البيانات طفرة الماوس، ونحن نقدم بيانات النشوء والتطور مقارنة البروتينات BBS الإنسان وجينومات الكائنات النموذجية. تدل هذه البيانات على الحفاظ على ذات دلالة إحصائية من البروتينات في الكائنات BBS المهدبة أقل، ودعم دور للبروتينات BBS في وظيفة الأهداب. والاستثناء الوحيد لهذه المحافظة هو BBS6. قد يشير هذا إلى أن هذا البروتين هو ليس من الضروري مباشرة للحصول على وظيفة الأهداب في هذه الكائنات. من الفائدة ملاحظة أن ذبابة الفاكهة لديهم المتماثلات لBBS1، BBS4، وBBS8، ولكن ليس لBBS2، وBBS7، مما يوحي بأن BBS1، BBS4، وBBS8 مطلوبة من أجل وظيفة. من المذكرة، وتوفر البيانات النشوء والتطور استراتيجية لتحديد الجينات البشرية الأخرى المعنية في وظيفة الأهداب، والمرشح بالتالي إضافي الجينات BBS. عن طريق تحديد الجينات البشرية التي يتم حفظها على وجه التحديد في الكائنات مهدبة (خصوصا الكائنات مع أحجام الجينوم صغيرة نسبيا) ولكن ليس الحفظ في الكائنات nonciliated، يمكن للمرء تحديد مجموعة فرعية من الجينات التي يتم إثراء للجينات التي تخدم وظائف أهداب ذات الصلة. قوة هذا النهج هو واضح عندما ينظر المرء أنه بالرغم من أن أحجام الجينوم من نوعين المثقبيات هي ≈1٪ من الجينوم البشري، ديهما المتماثلات للجينات BBS.
ومن غير الواضح لماذا عدم وجود Bbs4 يؤدي إلى السمنة. هذا وقد تمثل هذا التأثير مستقل عن دور Bbs4 في وظيفة الهدبية. بدلا من ذلك، فإن وجود السمنة باعتبارها عنصرا رئيسيا من النمط الظاهري BBS قد تشير إلى وجود صلة لم تكن معروفة سابقا بين الوظيفة الهدبية والحفاظ على وزن الجسم المناسب Bbs4 - / - الفئران تبين زيادة الاستهلاك الغذائي بالمقارنة مع الحيوانات مراقبة؛ وبالتالي، مهما كان الدور الذي تلعبه Bbs4 في تنظيم كتلة الجسم يبدو أن تنطوي على تنظيم الشبع. نقص Bbs4 قد يؤدي إلى فقدان الخلايا العصبية طائي المحددة المعنية في الشبع، أو قد يؤدي إلى فشل نقل الخلايا من المكونات الأساسية للخلايا العصبية المهاد.
وسوف تكون ذات فائدة لتحديد ما إذا كان التفاعل الجيني للبروتينات BBS تحدث، سواء الجينات BBS تشكيل مجموعات تكامل، وعما إذا كانت مجموعات من العجز الجزئي (أي الطفرات متخالف) في اثنين أو أكثر من مواضع تؤدي إلى الظواهر BBS. في البشر، هناك بين الوكالات واسعة والتباين المظهري داخل الأسرة، مما يشير إلى وجود مواضع معدل (15، 16). توليد Bbs4 الفئران خروج المغلوب هو خطوة نحو التحقيق في دور المعدلات الوراثية في BBS. وتجدر الإشارة إلى أن عناصر من النمط الظاهري (السمنة، وتنكس الشبكية، والعقم) يبدو أن توغل كبير في الحيوانات درس حتى الآن. هذه النتيجة تدعم الفرضية القائلة بأن في البشر، ورثت BBS ومرض وراثي جسمي مقهور مع التعبيرية متغير (17). بل هو أيضا من الفائدة التي Bbs4 - / - الفئران ليس لديها بعض مكونات النمط الظاهري البشري، وأبرزها polydactyly. وسوف تكون ذات فائدة لتحديد ما إذا كان عدم وجود polydactyly غير محددة لالفئران Bbs4 فارغة وإذا كانت هناك مكونات الجينات المحددة من النمط الظاهري BBS

رافت ابراهيم 11-23-2015 08:02 PM

خصائص قليل الجينات متلازمة بارديه-بيدل

متلازمة بارديه-بيدل (BBS: OMIM 209900) هو اضطراب في النمو النادر أن يسلك كبير عدم التجانس السريرية والجينية. على الرغم من أن غرار البداية كصفة متنحية بحتة، وغير المقنعة البيانات الأخيرة لوضع قليل الجينات من انتقال المرض، الذي الطفرات في مختلف BBS مواضع يمكن أن تتفاعل وراثيا في بعض العائلات أن تسبب و / أو تعديل النمط الظاهري. هنا، وسوف استعراض ومناقشة التطورات الحديثة في توضيح الجوانب سواء الوراثية والخلوية من هذا النمط الظاهري والتطبيق المحتمل في فهم الأساس الجيني للالتباين المظهري والميراث قليل الجينات.
القسم السابق القسم التالي
تلقى 29 يناير 2004؛ المنقحة والمقبولة 9 فبراير 2004


وقد وفرت العقدين الماضيين أمثلة عديدة حيث تم عزا الأساس الجيني للمرض البشري بشكل مقنع إلى حدوث طفرات في مكان معين. هذا التقدم، ومع ذلك، فقد أثارت أيضا تحديات جديدة كبيرة. الأكثر إثارة للمشاعر هو إدراك أن للأغلبية الساحقة من الجينات المرتبطة الصفات المندلية، ومعرفة التركيب الوراثي في مكان واحد يمكن أن لا يتوقع ولا يفسر مرض مظاهر المظهرية في أي مريض معين أو عائلة (+1 - 3). وقد أدى ذلك إلى استكشاف الفرضيات والنماذج تعديل الموقع الثاني، الذي ينص على الأليلات في مواضع إضافية تؤثر على نتائج المظهرية لطفرات في مكان واحد، وأساسا إلغاء مندلة الصفات أحادية المنشأ (4).
على الرغم من بعض النجاح في قياس تعديل الموقع الثاني في البشر (2، 5) والكائنات نموذج (6، 7)، فهم التفاعلات الوراثية، والكيمياء الحيوية في نهاية المطاف، من اثنين من الجينات ومنتجاتها يبقى مهمة صعبة. بعض المشاكل الجذعية إما من قدرة محدودة لدينا لقياس مساهمة الأليلات محددة إلى النمط الظاهري (ينظر بشكل خاص أليل "ضعيفة"، مثل بعض الطفرات مغلطة) أو من محدودية المعلومات المجراة حول الخصائص الكيميائية الحيوية والخلوية للمنتج الجين قيد التحقيق.
متلازمة بارديه-بيدل (BBS) هو النمط الظاهري يمكن أن تكون مفيدة للتحقيق في بعض هذه القضايا، لأن المرض يمكن أن تفصل في الأسر على حد سواء باعتبارها راثي متنحي الكلاسيكية وسمة digenic. وعلاوة على ذلك، المعلومات الفنية بدأت في الظهور حول الدور الخلوية من البروتينات BBS، وتقدم إمكانية نمذجة الأساس الخلوي للتفاعل الوراثي وتطبيق الدروس المستفادة لقليل الجينات والصفات المعقدة.

التحدي الجيني للBBS

BBS هو النمط الظاهري multisystemic تتميز في المقام الأول عن السمنة، تنكس الشبكية، polydactyly، الغدد التناسلية وتشوه الكلوي والمشاكل السلوكية والتنموية. وبالإضافة إلى ذلك، تم الإبلاغ عن المرضى الذين يعانون من BBS مع مجموعة من المظاهر السريرية شديدة التباين التي تتراوح من أمراض الشعب الهوائية رد الفعل إلى مرض نفسي (لمناقشة متعمقة من النمط الظاهري نرى +8 - +11). اضطراب غير شائع نسبيا في شعوب القوقاز، بمعدل انتشار يقدر ب 1: 140 000-160 000 ولادة حية في أمريكا الشمالية وأوروبا (12، 13)، على الرغم من أن أعلى معدل تم الإبلاغ في السكان المعزولين في نيوفاوندلاند [1: 13 000 (9)] والكويت [1: 17 000 (14)]. يمثل النمط الظاهري BBS لغز الجيني صعبة، منذ يقترح خسارة أو خلل في بروتين واحد أن تؤدي إلى وخصائص multisystemic المتميزة للمتلازمة، بما في ذلك التقدمية (مثل ضمور شبكية العين والسمنة) والهيكلية (مثل polydactyly والكلى الخراجات) العيوب. وعلاوة على ذلك، BBS يسلك التباين المشترك بين وداخل الأسرة الكبير، الذي هو أيضا من الصعب التوفيق مع احد الجينات جسمية نموذج المتنحية. وأخيرا، على الرغم من التوقعات الأولية إلى أن معظم الأسر BBS ستسند إلى نفس الموضع، والطفرات الإحصائي الأدلة الناشئة واقترح عدم التجانس الوراثي كبير، مع ما لا يقل عن تسعة مواضع في الجينوم.


بعد توقف دام 7 سنوات بين التعيين من أول موضع BBS، BBS2 (15)، واستنساخ الجين الأول، BBS6 (16، 17)، وأحرز تقدما كبيرا في السنوات ال 3 الماضية في توضيح الأساس الجيني لل BBS. في الوقت الحاضر، هناك ستة جينات BBS المعروفة (الجدول 1). اثنين من أكثر مواضع، BBS3 (18) وBBS5 (19) تم تعيينها والبيانات طفرية / الوراثية في أفواج كبيرة تشير إلى وجود واحد على الأقل من موضع، وذلك لأن الأسر العديدة تؤوي أي طفرات في الجينات الستة المعروفة ويمكن استبعادها من جميع مواضع ثمانية من خلال تحليل النمط الفرداني (20 - +22). الأهم من ذلك، أكثر من مواضع معروفة تؤوي الطفرات المسببة للأمراض في نسبة صغيرة من الأسر BBS (الشكل 1). حتى BBS1، والذي يعتبر البداية ليكون موضع كبيرا للمتلازمة، مع المساهمة المتوقعة من 40-50٪ (+23 - 25)، وتحور فقط في 20-25٪ من القوقازيين ونادرا ما في البدو، واحدة من المجموعات العرقية الرئيسية مع حدوث BBS عالية (26). على هذا النحو، فمن المرجح إما أن يبقى موضع رئيسي آخر BBS ككل، أو أكثر تحديا، أن ما تبقى من> 50٪ من BBS يتم توزيعها بين عدد كبير من الجينات، كل منها يساهم نسبة متواضعة إلى تجمع طفرة BBS.
الشكل 1. مساهمة معروف BBS مواضع ثمانية إلى BBS. تم تعيين الأسر التي لديها ثلاثة الطفرات إلى موضع الأساسي (واحد مع اثنين من الطفرات). وقدرت مساهمة BBS3 وBBS5 من بيانات التركيب الوراثي فقط، لأنه لا الجين المعروف حتى الآن.

الجدول 1.
الجينات BBS معروفة ومنتجاتها

التعديل الثاني-SITE في BBS

كل من التجانس الوراثي كبير وتقلب السريرية في BBS تشير إلى أن الموقع الثاني-التعديل الوراثي هو المرجح للغاية، حيث طفرات في الجين الثاني قد تعدل انتفاذ و / أو التعبيرية من الطفرات المتنحية في موضع الابتدائي. ما هو أكثر إثارة للدهشة، ومع ذلك، هو أن الجينات BBS مختلفة تظهر الآن قادر على تحمل إما سببية أو دور المعدلة في عائلات مختلفة، قد يخلق نموذجا جديدا من انتقال المرض بين البشر. أول دليل غير مباشر لهذه الظاهرة نشأت بعد استنساخ أول جين BBS، BBS6 (16، 17). الطفرات مفصلة وتحليلات النمط الفرداني في كبيرة، فوج متعددة الأعراق كشف نوعين من الانحرافات المحتملة من محض نماذج الفصل الأمراض المندلية. أولا، في معظم الأسر التي لديها طفرات BBS6، لا يمكن التعرف على أليل متحولة الثاني، على الرغم المباشر التسلسل صبغ التمهيدي من كامل BBS6 كدنا] (27). هذا يزيد من احتمالات أن هناك إما تيرة عالية من نوع الطفرات لا يمكن الكشف عنها من قبل المنهجية (مثل الحذف كبيرة، والتحكم في الاضطرابات عنصر، الخ) أو أن BBS6 قد يشارك في الميراث معقدة. الثانية، وأكثر من الفضول، تم العثور على طفرة A242S متخالف واحد في الأسرة الأقارب واحدة من نيوفاوندلاند (27) الذي كان متوقعا في السابق عن طريق تحليل مفردات لتعيين BBS2 (28). من غير المرجح أن تكون حميدة، لأسباب ليس أقلها أنها ارتبطت في السابق في ولاية متماثل مع متلازمة ذات الصلة ظاهريا McKusick-كوفمان (MKS) (هذا البديل 29). الأهم من ذلك، كان كل من الأشقاء المتضررة وغير المتضررة النسخ المتنوعة متطابقة حول كل من الكروموسومات في منطقة 5 سم تتمحور حول BBS6، مشيرا إلى أنه إذا كانت الطفرة الثانية الحاضرة في هذا الموضع، سواء sibs سيكون له أنها قد ورثت ذلك، على الرغم من واحد منهم كان سواء ظاهريا وضعها الطبيعي وأبعد من متوسط ​​العمر من ظهور هذا الاضطراب. وكان التفسير أكثر شحيح جدا أن أليل A242S قد تتفاعل وراثيا مع الطفرات في موضع آخر BBS (المتوقع في هذه الحالة أن يكون BBS2). تم اختبار هذه الفرضية مباشرة على استنساخ الموضعية من BBS2 (30) عن طريق فحص الفوج نفسه بغض النظر عن الربط التأكد سابقا أو معلومات طفرة وراثية. وقد تم تحديد أربع سلالات ايواء التعديلات المسببة للأمراض المحتمل في كل BBS2 وBBS6، بما في ذلك الأسرة المذكورة أعلاه من نيو فاوند لاند، الذي يتأثر، ولكن ليس السيب تتأثر يضمرون طفرة متماثل Y24X هراء في BBS2 (31). في الثانية الأسرة القوقازية الأباعد، سواء المتضررين وكان أحد السيب تتأثر متخالف مركب لمدة الطفرات هراء BBS2. فقط السيب المتضررين، ومع ذلك، قامت طفرة هراء متخالف إضافية في BBS6. وبناء على هذه البيانات، واقترح نوعا جديدا من تعديل الموقع الثاني، وصف الميراث triallelic، حيث كانت ثلاث الأليلات الطافرة على اثنين من مواضع اللازمة لالإمراضية (31).

تقييم TRIALLELIC الميراث ACROSS GENES BBS المعروفة

وبعد اكتشاف الإرث triallelic، وفحص BBS6 في جماعة مستقلة كشفت عن وجود فائض ملحوظ من الأسر التي لديها طفرة واحدة يمكن تحديدها BBS6 (خمس أسر) في مقابل اثنين الطفرات المتنحية (عائلتين). ومع ذلك، لا النية الحسنة triallelic تم تحديد مجموعات، مما يشير إلى أن الطفرات BBS6 قد تتفاعل وراثيا مع مواضع أخرى (32). استنساخ الجين BBS الثالث، BBS4 (33)، وقدم بعض الأدلة على أن مشاركة triallelic الأليلات الطافرة لا يقتصر على BBS2 وBBS6 منذ واحد، متخالف، من المحتمل تم العثور على الطفرات المسببة للأمراض في ثلاث عائلات (34). يثير الاهتمام والفضول، في أسرة الأقارب الرابعة من أصل كردي، قام الفرد المصاب طفرات متماثل في كلا BBS2 (T558I) وBBS4 (A364E)، في حين أن كلا من الأم والأخ تتأثر قامت ثلاث الأليلات الطافرة (34).
الاستنساخ من BBS الجين الرابع، BBS1 وتحليل نص لالميراث تعقيدا، ومع ذلك، اقترح أن triallelism قد لا تكون ظاهرة في كل مكان في BBS. الأسر التي لديها طفرات BBS1 ورثت هذه الصفة بطريقة المتنحية، على الرغم من الطفرة المسببة الثانية لا يمكن العثور عليها في نسبة صغيرة من sibships (35، 36). في اتفاق مع هذه البيانات، ذكرت Fauser وزملاؤه الميراث معقدة في BBS2 وBBS4 ولكن ليس BBS1 في لفيف من 21 مريضا لا علاقة لها (22). ومع ذلك، فإن استنساخ BBS7 تتناقض هذه النتائج، منذ طفرة E237K متخالف في BBS1 فصلت مع المرض في عائلة من أصل اسباني ايضا ان يحمل طفرة T211I متماثل في BBS7 (21). قدم تحليل لفيف أكبر من 259 أسرة مستقلة من خلفيات عرقية متنوعة عدة أسطر من الأدلة على أن BBS1 تشارك في triallelism. وشملت هذه تحديد ست عائلات مع اثنين من الطفرات BBS1 وطفرة الثالثة في موضع آخر BBS وعائلتين فيه أحد الوالدين يتأثر هو متماثل لطفرة M390R (26)، والبديل BBS1 الأكثر شيوعا في القوقازيين (35).

AN VIEW المتطورة للأليل المساهمة في TRIALLELIC الميراث

مقارنة بين التردد النسبي للtriallelism موثقة (ثلاث طفرات) أو triallelism توقع (اثنين من الطفرات في الأقارب أعراض أو طفرة واحدة في أسرة المستثناة بموجب الربط) في كل البرامج الجينات BBS اختلافات ملحوظة بين مواضع (الشكل 2 A). من كل البيانات المتاحة حتى الآن، BBS2 وBBS6 المشاركة في أغلب الأحيان في مجموعات triallelic. في المقابل، والطفرات في BBS1 يبدو كافيا للتسبب المرض في أكثر من 80٪ من المرضى BBS1، الذي قد يفسر في جزء البيانات المتناقضة بشأن إشراك BBS1 في الميراث triallelic. في الوقت الحاضر، لم يتم بعد تورط فقط موضع BBS8 حددت مؤخرا في مثل هذه الظواهر الوراثية (20)، على الرغم من أن هذا قد يعكس عدد صغير (ثلاثة) من الأنساب المرتبطة موعد مع BBS8.
الشكل 2. تحليل الطفرات triallelic. (A) بار الرسم البياني تصور نسبة الأسر يظهر الميراث المتنحية أو قليل الجينات (المساهمة إما واحد أو اثنين من الطفرات) في موضع. يشارك أي من أسر ثلاثة مع الطفرات BBS8 في الميراث triallelic. (B) نوع الطفرة مجموعات في الميراث triallelic. تم تصنيف الطفرات على نطاق واسع بأنها هراء (N)، مغلطة (M)، وصلة (S) أو غير معروفة (U). يشير هذا الأخير الحالات التي يتأثر أحد الوالدين أو السيب تتأثر يحمل اثنين من الطفرات في مكان واحد، ولكن لم يتم بعد تحديد أليل الثالث.

أنواع الطفرات المرتبطة موعد مع triallelism بدأت أيضا لتقديم بعض المؤشرات الفنية. حتى وإن كانت هناك أمثلة قليلة نسبيا المتاحة، فقد أصبح من الواضح أن مجموعات من ثلاثة بحسن نية خسارة كاملة من الأليلات وظيفة نادرة، مع واحد فقط مثال موثقة من ثلاثة الأليلات هراء يجري اللازمة لالمرضية (التي تشمل BBS2 وBBS6). تتكون تركيبات triallelic المتبقية في المقام الأول من اثنين أو ثلاثة من الطفرات مغلطة (الشكل 2 B). وهذا يثير التحدي المتمثل في تحديد إمكانيات المسببة للأمراض من الأليلات مغلطة.
تاريخيا، وقد نظرت في فصل البديل المرشح مع اضطراب مؤشرا قويا على الإمراضية. كما تم استخدام هذا المعيار في تقييم الطفرات triallelic المحتملة، نهج صحيح وفقا لنموذج السببية، حيث يفترض أليل متحولة الثالث من الضروري لمظهر من مظاهر المرض. ومع ذلك، وفصل الطفرات triallelic في الأسر BBS، إلى جانب المظهرية في المختبر تحليلات لمنتجات البروتين متحولة وأشار إلى أن بعض الطفرات قد تؤثر على شدة النمط الظاهري المتنحية، وبالتالي توسيع نموذج من الميراث triallelic لتغليف تعديل كل من انتفاذ والتعبيرية (37).
في ثلاث عائلات BBS، بعض، ولكن ليس تم الإبلاغ عن جميع المرضى قد ورثت أليل الإمراض الثالث، والتي ترتبط في كل حالة على حدة مع زيادة شدة المرض. وقد تم توثيق المشترك بين وداخل الأسرة المظهرية التباين نطاق واسع لBBS (8، 11)، أي تعقيد مثل هذه الارتباطات-النمط الظاهري النمط الجيني. ومع ذلك، واحدة من ثلاث عائلات، PB009، تؤوي طفرة M390R متماثل في BBS1، بالإضافة إلى تغيير L349W متخالف في BBS2 التي تفصل مع سن مبكرة من ظهور النمط الظاهري في شبكية العين (الشكل 3). ولذا كان من الممكن تحقيق التباين في سن بداية من اعتلال الشبكية، واحدة من الجوانب أكثر اتساقا من النمط الظاهري BBS، في الأسر المتنحية متعددة مع التركيب الوراثي BBS1 M390R وقارن الفرق مع أن الأسرة مع الطفرة BBS2 إضافية. والمثير للدهشة، كان فرق المتوسط ​​في عمر البدء في الأسر M390R المتنحية 3 سنوات فقط، مقارنة مع الفارق من 19 عاما لوحظ في sibship triallelic (37).
الشكل 3. ليس كل الأحداث تعديل الموقع الثاني في BBS هي السببية. في كل من العائلتين هو مبين، طفرة الثالثة في BBS6 وBBS2، على التوالي، يرتبط النمط الظاهري أكثر شدة، كما هو مبين تحت كل مريض. خ م = انزياح الإطار (1650 درجة مئوية)؛ MR = تخلف عقلي، RP = التهاب الشبكية الصباغي. البنك المركزي السويسري = العمى الليلي ثابتة.

وقد لوحظت ظاهرة مماثلة في غيرها من عائلتين، مع BBS1 وBBS6 كما المعدل الموقع الثاني. على سبيل المثال، في AR768 الأسرة، وطفرة BBS1، وتوقع طفرة لصق مفرق تؤدي إلى أليل باطل من قبل هراء التوسط الاضمحلال، والمترابطة مع تأخر في النمو في مرحلة الطفولة المبكرة، في حين أن طفرة مغلطة BBS6 T325P ارتباطا مع شدة زيادة من عدة جوانب من النمط الظاهري بما في ذلك السمنة، والتخلف العقلي وتأخر في النمو (الشكل 3). يثير الاهتمام والفضول، اقترحت الدراسات في المختبر في خلايا هيلا أن هذا البديل قد يكون له عواقب وخيمة على وظيفة البروتين، منذ الموسومة حاتمة overexpressed بنيات BBS6 تؤوي بقايا البرولين تشكلت رواسب هيولي غير قابلة للذوبان (37).
وبناء على هذه الأمثلة، تم اقتراح نموذج الانحدار لBBS، وتحويل النمط الظاهري من أحادية المنشأ لسمة الكمية، مع بداية وشدة المرض يتم عن طريق التضمين الأليلات إضافية، وعدد والمساهمة النسبية الذي هو غير واضح. هذا النموذج هو يتفق مع الأفكار الحالية للسببية المرض، حيث انتفاذ، التعبيرية وقشوة هي تمثيلات جزئية من سلسلة متصلة من التأثير الجيني (38، 39).

بعض الدروس وراثية جديدة

أن ميراث Triallelic وغيرها من أشكال تعديل الموقع الثاني-ربما يتطلب تعديل الطرق التقليدية لتقييم الجينات المرشحة. أولا، فإن الممارسة الشائعة المتمثلة في استبعاد عائلة من فحص إضافي مرة واحدة تم التعرف على "المسبب" طفرة ربما يؤدي إلى فقدان البيانات التفاعل الوراثية. هذا ينطبق بشكل خاص في الصفات غير المتجانسة وراثيا مثل BBS هذا. ولعله من الواضح بداهة أن الجينات المتعددة التي تؤدي إلى نفس النمط الظاهري هي مرشح قوي لتعديل الموقع الثاني، بعد كثير من الأحيان يتم تجاهل هذا الاحتمال.
التثبت من الطفرات قليل الجينات مرشح ويمكن أيضا أن يكون تحديا. أولا، ينبغي أن المعيار التقليدي الذي النية الحسنة الطفرات لا تكون موجودة في الكروموسومات السيطرة، وعدد من التي تمليها عادة من قبل حدوث السكان من المرض، لم يعد من الممكن تطبيقها. إلا بعض الأليلات تشارك في الميراث قليل الجينات لها تردد مرتفعة في عموم السكان، فإن فرصة للفرد وراثة ثلاثة أو أكثر من الطفرات في نفس الوقت أن تكون صغيرة، وهي ليست كذلك. على سبيل المثال، وانتشار الطفرة M390R المشتركة في BBS1 في القوقاز هو ~1: 325، مقارنة مع تردد المتوقع من 1: 1000-2000 بموجب نموذج المتنحية (26).
وأخيرا، فإن الفصل بين متغير يمكن أن يؤدي أيضا إلى underappreciation من تأثير أليل على النمط الظاهري. وفقا لنموذج أحادي الجين، قد تم تجاهل العديد من الطفرات في الجينات ينظر BBS كما حميدة (بما في ذلك طفرة لصق تقاطع في BBS1)، في حين قدمت فرضية روكبي تفسير أكثر شحيح جدا من هذه البيانات (37). يمكن نمذجة هذه التفاعلات الوراثية يمكن أن يكون تحديا، مع خطر حقيقي من التخمة وتحت تفسير البيانات طفرية. ومن المرجح أن يتيسر من خلال تطوير البيانات الخلوية والمقايسات البيوكيميائية التي يمكن اختبار مباشرة تأثير البديل على جين معين، والمنتج والمسار (ق) في تأدية وظائفه مثل هذه المساعي.

نحو فهم الخلوي والبيوكيميائية OF TRIALLELISM

وعلى الرغم من إحراز تقدم كبير في توضيح الأساس الجيني من اضطرابات قليل الجينات، وترجمة البيانات الوراثية لنماذج الخلوية لا تزال بعيدة المنال إلى حد كبير. ظهرت نماذج التفاعل المباشر من دراسة الخواص الكيميائية الحيوية من ROM1 وRDS، التي تتفاعل وراثيا لتسبب digenic التهاب الشبكية الصباغي (40) والتي تشكل tetramers (منتجات البروتين +41 - 43). وقد أثبتت أزواج أخرى من التفاعلات الجينية إلى أن أكده علاقات مماثلة، مثل أزواج مستقبلات يجند من JAG1 مع NOTCH2 في متلازمة Allagille (44) وRET-GDNF في مرض هيرشسبرونغ (45؛ انظر 2 لمناقشة المزيد من التفاصيل لهذه نماذج).
وقد أشارت الدراسات الخلوية الأولية أن البروتينات BBS قد تلعب دورا في وظيفة المنطقة محيط بالمريكز، لأن اثنين من البروتينات BBS، BBS4 وBBS8 عرضت، في توطين تحديدا إلى الهيئات القاعدية وcentrosomes من أنواع مختلفة من الخلايا (20). علاوة على ذلك، C. عرضت orthologs ايليجانس من BBS1، BBS2، BBS7 وBBS8 أيضا أن أعرب تحديدا في نهايات الجذعية مهدبة الخلايا العصبية الحسية، مما يزيد من احتمال أن الخلل في الجسم القاعدية في الخلايا المهدبة قد تكمن وراء عدة جوانب من النمط الظاهري (20). وبالنظر إلى أن لا توجد فروق ملحوظ بين النمط الظاهري التي تسببها طفرات في كل من الجينات BBS معروف، فإنه ليس من المستغرب أن البروتينات BBS تتقارب إلى مجموعة مشتركة من الوظائف الخلوية ويبدو أن تشارك في أعربت (على الأقل في أقل الكائنات الحية) في أنواع الخلايا نفسها. ومع ذلك، ما هو من أكبر أهمية الوراثية، هو أن كل من BBS4 وBBS8 يتفاعل مع نفس محيط بالمريكز البروتين، PCM1 (20)، على الرغم من أن الجزيئية للتفاعل لا يزال يتعين حلها. في الوقت الحاضر، لا يوجد أي دليل على التفاعل المباشر بين BBS4 وBBS8، أو في الحقيقة أي زوج البروتين BBS (بيانات غير منشورة لدينا)، مما يدل على أن نموذج معقد المباشر أقرب إلى ROM1-RDS، JAG1-NOTCH2 وغيرهم من غير المرجح. بدلا من ذلك، البروتينات BBS قد يشارك في مجمع multiprotein أن يصبح خطر تدريجيا من خلال وجود طفرات إضافية. بدلا من ذلك (أو إضافة) لأنها قد تتصرف بشكل متتالي أن تؤثر على عملية الخلوية نفسها، مثل النبات من المواد لمنطقة محيط بالمريكز أو الخيط المحوري للهدب.


توضيح الآليات الوراثية والخلوية التي تكمن وراء الموقع الثاني المظهرية تعديل مهم لفهم المرض قليل الجينات، وأيضا قالب النمذجة مفيد لصفات معقدة، حيث كل من عدد الأليلات المشاركة ومساهمة العوامل العشوائية تشكل عقبات كبيرة. BBS بالتالي هو نظام الدراسة مفيدة للفك رموز هذه التفاعلات على حد سواء على المستوي الجيني وعلى المستوى الخلوي. منذ التقرير الأصلي من الميراث triallelic، تم الإبلاغ عن العديد من الظواهر غير ذات صلة في إظهار أوضاع مماثلة من انتقال الأمراض، بما في ذلك المتلازمة الكلوية (46)، ونقص اختزال الكورتيزون (47)، الاصطباغ الدموى (48) وhypercholanemia الأسرية (49)، مشيرا إلى أن هذا ولا تقتصر ظاهرة الوراثية لBBS. وتشير الناشئة نماذج حيوانية أن التفاعل الجيني لوحظت في بعض المرضى قد BBS تلخيصها (50، 51). هذه، جنبا إلى جنب مع الدراسات البيوكيميائية من النوع البري والبروتينات BBS متحولة سوف تكون أدوات هامة لتشريح الأساس الخلوي للtriallelism وتطبيق الدروس المستفادة نحو أحادية المنشأ والصفات المعقدة على حد سواء.

رافت ابراهيم 11-23-2015 08:07 PM

بارديه-بيدل متلازمة: دراسة في الكلى والقلب والأوعية الدموية الظواهر في الفوج الفرنسي
الخلفية والأهداف بارديه-بيدل متلازمة (BBS) هو نادر وراثي جسمي مقهور ciliopathy مع طائفة واسعة من المظاهر السريرية بما في ذلك السمنة، التهاب الشبكية الصباغي، polydactyly، والتخلف العقلي، قصور الغدد التناسلية، والشذوذ الكلوي. ويجري حاليا التحقيق في الصورة الجينية الجزيئية من BBS بعد تحديد مؤخرا من 14 جينات BBS تشارك في أمراض مرتبطة أهداب الابتدائي. وتهدف هذه الدراسة إلى تحديد خصائص العروض الكلى والقلب والأوعية الدموية، وتحليل العلاقات الممكنة بين الأنماط الجينية والظواهر السريرية.
تصميم وإعداد والمشاركين وقياسات أجريت هذه الدراسة السريرية في لفيف وطنية من 33 مريضا BBS، 22 رجلا و 11 امرأة، وجميع الذين تتراوح أعمارهم> 16 سنة (متوسط ​​العمر 26.3 سنة).

النتائج تشوهات الكلى، بما في ذلك ضعف وظائف الكلى وعلامات اعتلال الكلية الخلالي المزمن الطبيعة خلل التنسج، تم توثيقها في 82٪ من المرضى. وأظهرت التقييمات القلب والأوعية الدموية أن هذه المجموعة من المرضى الصغار كانت عوامل الخطر القلبية الوعائية كبيرة. تم العثور على ارتفاع ضغط الدم في> 30٪ من المرضى والدهون في> 60٪، وكان ما يقرب من 50٪ حالات الشذوذ الأيضي الأخرى. كان مرض السكري الصريح الحالي في 6٪ فقط. وفيما يتعلق الوراثي، النمط الظاهري الارتباط، وكان المرضى الذين يعانون من طفرة في BBS6، BBS10، أو الجينات BBS12 (10 من 33 مريضا) أمراض الكلى أكثر شدة.

استنتاجات نتائج دراستنا تؤكد تكرار وقوع تأثر الكلى في المرضى الذين يعانون من BBS، تؤكد ارتفاع مخاطر أمراض القلب والشرايين في هؤلاء المرضى، وتوفر معلومات جديدة عن احتمال وجود علاقة الوراثي، النمط الظاهري.


بارديه-بيدل متلازمة (BBS، OMIM 209900) هي نادرة، وراثية، ciliopathy تتميز السمنة الأحداث، قصور الغدد التناسلية، polydactyly، ضمور شبكية العين، والتخلف العقلي، والشذوذ الكلوي. ارتفاع ضغط الدم و / أو مرض السكري عادة يحدث (1، 2).
حتى الآن، وقد تم تحديد 14 جينات BBS المسببة لل(BBS1 من خلال BBS14، لاستعراض رؤية BBS، OMIM 209900). سبعة من البروتينات BBS الأكثر الحفظ (BBS1، BBS2، BBS4، BBS5، BBS7، BBS8، وBBS9) تشكيل مجمع مستقرة تسمى BBSome (3)، باستثناء ثلاثة بروتينات أخرى، BBS6، BBS10، وBBS12، التي هي vertebrate- البروتينات مثل chaperonin محددة (4). ويعتقد أن البروتينات BBS أن تشارك في نشوء حيوي والحفاظ على أهداب / مجمع الجسيم المركزي الابتدائي، وتكون مرتبطة مع مسارات الإشارات الأساسية (5). A طفرة جينية BBS يؤدي إلى اضطراب في عدة طرق يشير، على وجه الخصوص، مسار WNT noncanonical تشارك في الخلية القطبية مستو التي تلعب دورا في التسبب في مرض الكلى المتعدد الكيسات، التي وصفت (6، 7). وقد لوحظت معظم الصفات المظهرية لBBS في النماذج الحيوانية (8 - 11). النتائج الأخيرة في نموذج الفأر من Alström المكتسب (OMIM 203800) -also على ciliopathy ترتبط ارتباطا وثيقا BBS، وتتميز تشوهات الكلى، والسمنة، ومقاومة الأنسولين، توحي تشوهات داخل الجسيم المركزي كونها سبب هذا الاضطراب (12).
BBS هو من مصلحة لأمراض الكلى لعدة أسباب. تحديد الجينات المسؤولة عن BBS والآليات الجزيئية ذات الصلة يمكن أن تزيد فهمنا ليس فقط لتطور أمراض الكلى في BBS والأمراض المتداخلة والأمراض وciliopathies تكيس الكلى، ولكن أيضا من الصفات المظهرية أكثر شيوعا بما في ذلك السمنة وارتفاع ضغط الدم، و داء السكري. من جميع الميزات من BBS، وقد تم دراسة عيوب الكلى أكثر على نطاق واسع، وقد تم الإبلاغ عن التباين في التعبير السريري وشدة المرض (13، 14). في المقابل، فإن الملف الشخصي القلب والأوعية الدموية للمرضى BBS وعوامل الخطر القلبية الوعائية لم يتم تتميز أيضا (15، 16). وأخيرا، لا يزال هناك جدل حول علاقة الوراثي، النمط الظاهري في هذا المرض عديد المظاهر مع الميراث قليل الجينات ممكن (17، 18).
وكان الهدف من هذه الدراسة هو تحليل خصائص الكلى والقلب والأوعية الدموية من 33 مريضا تتأثر BBS واستكشاف العلاقات المتبادلة المحتملة بين النمط الجيني والنمط الظاهري.

المواد والأساليب

السكان الدراسة

تكونت مجموعة الدراسة من 33 شابا الفرنسي (الذين تتراوح أعمارهم> 16 سنة) بمتوسط ​​عمر (± SD) 26.3 (7.7) سنة ونسبة الذكور إلى الإناث من 2: 1. وتم متابعة المرضى في المركز (ق) في ستراسبورغ = 19) ومرسيليا = 8)، مونبلييه = 4)، وليل = 2). تم تشخيص BBS باستخدام معايير Beales (1) استنادا إلى جمعية من الأعراض الأساسية للمرض بما في ذلك التهاب الشبكية الصباغي، polydactyly، والسمنة، والتخلف العقلي، قصور الغدد التناسلية، والشذوذ الكلوي. تم قبول تشخيص BBS إذا كانت ثلاثة من الأعراض المذكورة أعلاه موجودة، أو اثنين من الأعراض الثلاثة الأولى المذكورة، أو إذا كان اثنان أعراض الحالية وتم الكشف عن طفرة جينية في واحدة من الجينات BBS (الجدول 1). وتضمنت معايير الاستبعاد العمر <16 سنة، والحمل، ومرض قبل الشفاء.

الجدول 1.
توزيع BBS معايير التشخيص لإدراجها

تم الحصول على البيانات من المرضى الذين يعانون من BBS يتبع ما بين مارس 2003 ومارس 2007. وتمت الموافقة على الدراسة من قبل لجان أخلاق المحلية وجميع المرضى أعطى موافقة مستنيرة.


تقييم الكلى.

وشملت المعلمات البيولوجية مستويات بلازما الدم من الكرياتينين والبوتاسيوم والبيكربونات، تحليل البول على مدار 24 ساعة من الكرياتينين، والبروتين، ومستويات الزلال. وقد تم تعريف غير طبيعية البول التركيز القدرة عن عدم وجود زيادة في الأسمولية ل> 750 الميلي أسمول / كغ H 2 O بعد فترة 12 ساعة من تقييد الماء. أجريت الموجات فوق الصوتية الكلوي وبطني حوضي التصوير بالرنين المغناطيسي (MRI) في معظم المرضى. وقدرت GFR باستخدام القياس المباشر البولية تصفية الكرياتينين (UCcr) أو مع أربعة متغيرة تعديل النظام الغذائي في مرض الكلى (MDRD) صيغة (GFR يقدر [اريسا]) (19). وجاء انطلاق من مرض الكلى المزمن (CKD) توصيات KDIGO 2005 بما في ذلك علامات الفشل الكلوي، بروتينية، بيلة دموية، وتشوهات في اختبارات التصوير (20). تم تعريف البول الزلالي في البول غير طبيعي من قبل الزلال البولي إلى نسبة الكرياتينين (UACR)> 30 ملغ / غ (20).

تشوهات القلب والأوعية الدموية والتقييمات عوامل الخطر.

تم توثيق التواريخ الشخصية والعائلية من أعراض القلب، وكذلك علاج القلب والأوعية الدموية الحالية. وشملت التحقيقات السريرية الجلوكوز في الدم أثناء الصيام، الكوليسترول الكلي، HDL، LDL، الفيبرينوجين، وleptinemia. وقد تم تعريف الحساسية المفرطة تجاه الجلوكوز من مستوى الجلوكوز في بلازما الدم من> 140 ملغ / دل ولكن <200 ملغ / ديسيلتر في الساعات 2 بعد تحميل الجلوكوز عن طريق الفم وغير طبيعية من السكر في الدم أثناء الصيام قبل بلازما الجلوكوز اثناء الصوم (FPG)> 110 ملغ / ديسيلتر ( منظمة الصحة العالمية 1999). تم إجراء قياس BP الإسعافية خلال فترة 24 ساعة. أجريت الكهربائي وتخطيط صدى القلب عبر الصدر لقياس أبعاد البطين في وضع TM مع تقدير البطين الأيسر تطبيع الشامل للارتفاع 2.7 النحو الموصى به في السمنة. واستندت تفسير هذه الأبعاد وحسابات الكتلة على المعايير المتفق عليها من قبل الجمعيات الأمريكية والأوروبية لضربات القلب (21). معايير NCEP-ATP III تعديل لأوروبا من قبل EGIR (22 استخدمت) لتعريف محيط الخصر غير طبيعي، ونسبة الخصر إلى محيط الورك، وتشخيص متلازمة التمثيل الغذائي.

التحليلات الجزيئية.

أجريت التحاليل الوراثية في مختبر علم الوراثة الطبية، كلية الطب، في ستراسبورغ (HD) ويتكون من الكشف عن الطفرات داخل BBS1 من خلال BBS12 الجينات، كما هو موضح سابقا (23).

تحاليل احصائية

يتم عرض النتائج على النحو يعني ± SD أو النسبة المئوية تحديد عدد من المرضى الذين يعانون علامة أو أعراض تلك درس للمتغير تحليلها. لدراسة الاختلافات بين المجموعات مع أو بدون أمراض الكلى، تم استخدام اختبار دقيق فيشر للمعطيات الفئوية. تم قبول دلالة إحصائية لP <0.05.


الظواهر الكلى (الجدول 2)

الجدول 2.
خصائص شذوذ وظيفي كلوي

باستخدام الصيغة MDRD، حددنا أن 36٪ (12 من 33) من المرضى كان لاريسا <90 مل / دقيقة لكل 1.73 م 2، منهم 9٪ (3 من 33) الفشل الكلوي المعتدل (EGFR بين 30 و 60 مل / دقيقة لكل 1.73 م 2). القياس المباشر للUCcr في 31 مريضا كشفت أن 48٪ (15 من 31) منهم كان UCcr أقل من 90 مل / دقيقة و 19٪ (6 من 31) وكان الفشل الكلوي المعتدل (UCcr <60 مل / دقيقة).
وكانت تشوهات مما يدل على الآفات tubulointerstitial متكررة مع تشوهات في تركيز البول في 63٪ من المرضى. تم العثور بروتينية في 33٪، وكان UACR غير طبيعي (> 30 ملغ / غ) في 31٪ من المرضى. من تسعة مرضى UACR مرتفعة، وأربعة كانوا ارتفاع ضغط الدم وكان واحدا كل من ارتفاع ضغط الدم والسكري. تم العثور على بيلة دموية مجهرية في اثنين فقط من المرضى.
تم إجراء الموجات فوق الصوتية الكلوي في جميع المرضى وأجريت MRI في 24 من 33 مريضا. تسعة مرضى لا يمكن أن يخضع MRI بسبب السمنة. وأكد تنمية الكلى غير طبيعية في ما يقرب من 50٪ من المرضى (الجدول 2). ولوحظ عدم التماثل أو ضمور الكلى والجانب غير متمايزة في إحدى أو كلتا الكليتين في 12٪ من المرضى. وكان متوسط ​​حجم الكلى (± SD) في المجموعة لكن العادي في 115 (12) × 47 (9) ملم. وكانت الخراجات القشرية عموما، وأربعة مرضى كانوا الانفرادي. لم أساليب التصوير لا تكشف عن وجود خلل التنسج الكيسي corticomedullary أو أكثر أشكال حادة من النمو الشاذ، مثل الكلى حدوة حصان أو لاتكون. أخيرا، 36٪ من المرضى يعانون من علامات تشير إلى CKD المرحلة 2 (27٪) لمرحلة CKD 3 (9٪) وتشوهات الكلى الشاملة، بما في ذلك على الأقل الكلوي وظيفة ضعف و / أو علامات الآفات tubulointerstitial الطبيعة خلل التنسج و / أو ضعف القدرة تركيز البول تم توثيقها في 82٪.

الظواهر القلب والأوعية الدموية (الجدول 3)

الجدول 3.
خصائص النمط الظاهري القلب

كان هناك انتشار قوي من ارتفاع ضغط الدم النظامية (36٪) في هذه الفئة من السكان الشباب. وكان ثلاثة مرضى أظهر التاريخ السابق لعلاج الخافضة للضغط وقياس BP الإسعافية القيم المتوسطة> 130/80 مم زئبق على مدى 24 ساعة في سبعة مرضى. من عشرة مرضى ارتفاع ضغط الدم، ثمانية منهم يعانون من السمنة المفرطة وأظهرت أربع علامات CKD. كان جميع المرضى قيمت الكهربائي العادي.
في أولئك الذين خضعوا لتخطيط صدى القلب عبر الصدر، لم يلاحظ أي valvulopathy أو تشوهات هيكلية. وكان اثنين من المرضى لديهم تاريخ معروف من الاتصالات البطين. وقد تجلى البطين الأيسر تمدد في مريض واحد فقط وعثر تضخم البطين الأيسر (تضخم البطين الأيسر) في 5 من 29 من المرضى. من هؤلاء المرضى خمسة، ثلاثة منها ارتفاع ضغط الدم. تم العثور على جزء قذف غير طبيعي قليلا (54٪) في اثنين فقط من المرضى.

عوامل الخطر القلبية الوعائية (الجدول 4)

جدول (4).
القلب والأوعية الدموية توزيع عوامل الخطر

بالإضافة إلى ارتفاع معدل انتشار ارتفاع ضغط الدم، تم العثور دسليبيدميا في 53٪ من المرضى الذين يعانون من زيادة في الكولسترول LDL> 160 ملغ / ديسيلتر في 9٪ من المرضى وانخفاض في الكوليسترول الحميد <40 ملغ / ديسيلتر في 47٪ من المرضى. وكانت تفاصيل عن تاريخ التدخين غير متوفرة. أي من المرضى كان له التاريخ الماضي أو تاريخ عائلي من مرض القلب والأوعية الدموية.
قدمت إحدى عشرة من 33 مريضا (33٪) مع ايض الجلوكوز غير طبيعي. وعولج اثنان لنوع 2 داء السكري في حين FPG و 2 ساعة الجلوكوز في البلازما (2-ح PG) مرض السكري استبعاد في الآخرين. وقد تجلى الحساسية المفرطة تجاه الجلوكوز في ستة مرضى، وكان ثلاثة مرضى آخرين لFPG غير طبيعي. تم العثور على زيادة شحوم الدم (> 150 ملغ / دل) في 22٪ من المرضى. واقترح A الخلايا البطانية بفضل وجود hyperfibrigenemia (> 4 ز / L) في 27٪ من المرضى والبول الزلالي الدقيق في 31٪ من المرضى. السمنة، وهو ما يعد مؤشرا أساسيا في هذه المتلازمة، كان موجودا في 70٪ من المرضى (مؤشر كتلة الجسم، و> 30 كجم / م 2). وكان الروبوت هذه السمنة بشكل رئيسي في توزيع مثل السمنة في منطقة البطن، كما يقاس محيط الخصر، ورقي في 79٪ (22 من 28) من المرضى الذين يعانون من السمنة المفرطة. كانت نسبة الخصر إلى محيط الورك غير طبيعية في 50٪ من المرضى (14 من 28). وأشار إلى hyperleptinemia المرتبطة بها (الدم leptinemia> 11 ميكروغرام / لتر) في 90٪ من المرضى. شذوذ المذكورة أعلاه تسمح استنتاج مفاده أن وجود متلازمة التمثيل الغذائي في 45٪ من المرضى (13 من 29) التي سيتم التوصل إليها (22).

راثى-النمط الظاهري إرتباطات

تم العثور على طفرة BBS1 الجيني في 37٪ من المرضى (12 من 33)، طفرة BBS10 في 15٪ (5 من 33)، وطفرة BBS12 في 12٪ (4 من 33) (جدول رقم 5). في 9٪ من المرضى (3 من 33)، لم يتم بعد تحديد تحور الجين ولكن يعتقد أن تتصل الجينات غير معروف حتى الآن. في هذه المجموعة، لم يتم العثور على طفرة في الجين BBS3، BBS7، أو BBS8. كان هناك حالة واحدة فقط من triallelism (BBS12 تحور متماثل، BBS3 تحور متخالف).

الجدول 5.
توزيع المورثات BBS من 33 مريضا المدرجة في هذه السلسلة حالة

الأرقام الصغيرة في كل مجموعة راثى لا تسمح استنتاجات قاطعة بشأن معينة الارتباط الوراثي، النمط الظاهري. ومن المثير للاهتمام، من بين المرضى الذين يعانون من طفرة BBS1، كانت 6٪ فقط (2 من 12) يعانون من السمنة المفرطة، وكان CKD. ومع ذلك، كان كل المرضى الذين يعانون من طفرة BBS12 (4 من 4) CKD ومعظمهم كانوا يعانون من السمنة المفرطة (3 من 4) وزيارتها حالات الشذوذ الأيضي (3 من 4). وهناك اتجاه مماثل يبدو أن تكون موجودة في المرضى الذين يعانون من طفرة BBS10. وكان 4 من 5 مرضى يعانون من السمنة المفرطة و1 من 5 لديه متلازمة التمثيل الغذائي. وهكذا، وبالنظر إلى الجينات الثلاثة الأكثر شيوعا، يبدو أن النمط الظاهري BBS1 كان أكثر موهنة من BBS10 وBBS12 الظواهر.
وهناك طريقة أخرى ذات الصلة لاستكشاف العلاقات المتبادلة الوراثي، النمط الظاهري في التحقيق الاختلافات المظهرية بين المرضى الذين يعانون من الطفرات على BBSome، وهذا هو، وBBS1 المحفوظة جيدا، BBS2، BBS4، BBS5، BBS7، BBS8، وBBS9 الجينات، والمرضى الذين يعانون من BBS الطفرات في الجينات BBS الأخرى (BBS6، BBS10، وBBS12) وجدت فقط في الفقاريات (الجدول 6). ويبدو أنه لا توجد فروق ذات دلالة إحصائية واضحة في النمط الظاهري مخاطر القلب والأوعية الدموية بين هاتين الفئتين من الجينات. على العكس من ذلك، المرضى الذين يعانون من الطفرات في الجينات الفقاريات محددة قدمت BBS6، BBS10، وBBS12 مع النمط الظاهري الكلوي أسوأ بكثير لأن 70٪ (7 من 10) كان تشخيص CKD مقارنة مع 15٪ (3 من 20) من المرضى الذين يعانون من BBSome الجينات طفرات (P <0.005).

الجدول 6.
العلاقة الوراثي، النمط الظاهري الكلى والقلب والأوعية الدموية. الجينات BBSome مقارنة مع جينات أخرى


هدفت هذه الدراسة إلى وصف الظواهر الكلى في عدد السكان من 33 شابا (متوسط ​​العمر 26.3 عاما) مع BBS، وهو أول من وصف الظواهر القلب والأوعية الدموية، وتقييم عوامل الخطر القلبية الوعائية لدى هؤلاء المرضى. دراستنا هي أيضا واحدة من عدد قليل من الدراسات التي قامت بالتحقيق العلاقات الممكنة بين النمط الجيني والنمط الظاهري في المرضى الذين يعانون BBS.
واحدة من النتائج الهامة من دراستنا هو تواتر حدوث المرض الكلوي، مهما كانت طبيعته، من 82٪، مما يؤكد أن إصابة الكلى هي واحدة من العلامات الأساسية للمتلازمة. وعلاوة على ذلك، ما يقرب من ثلث لدينا فوج من الشباب قدم مع وجود علامات متوافقة مع مراحل CKD 2 و 3. ومن المثير للاهتمام أن نلاحظ أنه في مجموعة من المرضى من كبار السن، أوديا وآخرون. وأشار إلى أن 100٪ من مرضاهم مع BBS كان تشوهات هيكلية الكلى وكان 25٪ انخفاض قيمة GFR في سن 48 عاما (24). في نفس الطريق، وذكرت ويب آخرون مؤخرا سلسلة نيوفاوندلاند من BBS مع انتشار مرحلة CKD 3 (EGFR <60 مل / دقيقة لكل 1.73 م 2) إلى 47٪ (20 من 43) في بداية العمر الوسيط للCKD من 58 سنة (25). المرحلة 4 CKD (EGFR <30 مل / دقيقة لكل 1.73 م 2) المعنية 20٪ من المرضى و 14٪ تقدما لالداء الكلوي بمراحله الأخيرة. وأكدت أطروحات الدراسات ارتفاع معدل انتشار CKD في المرضى الذين يعانون BBS بعد العقد الرابع وتعزيز ملاحظتنا أن أعراض الكلى قد تكون موجودة والكشف في المرضى الصغار الذين سوف تتطور الفشل الكلوي مع التقدم البطيء لالداء الكلوي بمراحله الأخيرة في وقت مبكر.
ترددات لوحظ من توسع الكأس وتفصص الجنين مستمر في سلسلة لدينا هي تدل على النضج الكلوي غير طبيعي كونه ميزة بارزة مرضية. تاريخيا، كانت حتى أكثر في كثير من الأحيان الكشف عن هذه التشوهات باستخدام تصوير الجهاز البولي عن طريق الوريد، والتي هي أكثر حساسية لتقييم ملامح كلاسيكية مثل diverticuli كأسي والتواصل الخراجات كأسي. في الواقع، ذكرت ترددات شذوذ الكيسي في المرضى الذين يعانون BBS تختلف اختلافا كبيرا، من 10٪ إلى 72٪ (14، 24). ويمكن أيضا أن تعزى هذه الاختلافات إلى عدم التجانس السريري في كل من العرض المرض والطبيعي حدوث الخراجات. في BBS، الخراجات توزيع يذكرنا nephronophthisies بدلا من مرض الكلى المتعدد الكيسات مع microcysts الناشئة عند تقاطع corticomedullary، أو ectasias من القنوات جمع والتي لا يمكن كشفها بسهولة عن طريق طرائق التصوير (14، 24).
والفشل الكلوي في BBS يشير نحو عملية tubulointerstitial مع بروتينية نادرا ما تتجاوز 1 غ لكل 24 ساعة وتشوهات في تركيز البول، مما يشير إلى خلل في النظام القناة جمع. وعدد قليل من الدراسات المرضية التي نشرت في الأدب يتفق مع هذه النتائج. ومع ذلك، كما تم الإبلاغ عن الآفات الكبيبي تتميز سماكة الغشاء القاعدي نشاهد في المجهر الإلكتروني (26، 27). وجود ACR غير طبيعية في 31٪ من المرضى تشير مرض الكبيبي المرتبطة بها، التي يمكن أيضا أن يكون من عواقب ارتفاع ضغط الدم على المدى الطويل أو مرض السكري. وفي هذا السياق، يمكن النظر أيضا بروتينية باعتباره علامة إضافية من مخاطر القلب والأوعية الدموية العالمي ارتفاع في هؤلاء المرضى.
المرضى الذين يعانون من آفات tubulointerstitial السائدة عموما لديهم بمعدل أبطأ من التقدم إلى الداء الكلوي بمراحله الأخيرة. ومع ذلك، في المرضى الذين يعانون BBS، يمكن تسارع هذا المعدل البطيء الكلاسيكي من قبل وقوع ما يصاحب ذلك من ارتفاع ضغط الدم أو مرض السكري والطولي متابعة فوج لدينا يمكن أن توفر، في المستقبل، وبيانات مثيرة للاهتمام على معدل معين من التقدم في المرضى الذين يعانون BBS مع مطلع تشخيص CKD.
هي البيانات المنشورة تقتصر على مخاطر القلب والأوعية الدموية للمرضى BBS المتاحة (16). على الرغم من صغر سنهم، ما يقرب من نصف مرضانا الصغار قدمت بالفعل معايير وضعها في المجموعة عالية الخطورة لتطوير أحداث القلب والأوعية الدموية. في سلسلة لدينا تظهر عوامل الخطر القلبية الوعائية الكلاسيكية لتكون أكثر تمثيلا بالمقارنة مع تلك الموجودة في فرنسا عموم السكان (28). تم العثور دسليبيدميا يرتبط مع انخفاض الكولسترول HDL في ما يقرب من نصف المرضى وأظهر ثلث المرضى بالفعل علامات ارتفاع ضغط الدم منها انتشار ينبغي أن تزيد أيضا مع تقدم العمر. انتشار مرض السكري أو الحساسية المفرطة تجاه الجلوكوز غير قابلة للمقارنة مع البيانات المنشورة (بين 6٪ و 48٪)، وربما يكون أيضا عرضة للزيادة مع تقدم العمر.
هذه الدراسة، وتقييم جوانب القلب والأوعية الدموية غالبا ما يتم تجاهلها من هذه المتلازمة، هي واحدة من أكبر الدراسات المنشورة. وقد اقترحت القلب الخلقية أو تضخم البطين الأيسر لتكون ذات قيمة محدودة في إرساء تشخيص BBS. Elbedour آخرون بعمل ضربات القلب منتظمة في 22 المرضى الذين يعانون من BBS وجدت سبعة مرضى (32٪) مع تشوهات قلبية (ثلاثة مع التشوهات الخلقية واثنين مع تضخم البطين الأيسر) (15). في هذه السلسلة، وكان اثنين فقط من المرضى (6٪) والتاريخ الماضي من الاتصالات البطين وعثر LVH في 17٪، معظمهم من ارتفاع ضغط الدم، مما يشير إلى أن تضخم البطين الأيسر يمكن أن تنتج عن الضرر نهاية الجهاز. المثير للاهتمام يعطى هذا التردد المنخفض نسبيا للتضخم البطين الأيسر تأثير مضافة المتوقع السمنة على وظيفة القلب.
ويعوق استكشاف الارتباطات المحتملة بين الأنماط الجينية والظواهر في فوج من المرضى BBS من عدم التجانس الوراثي للمرض. مور وآخرون لا يمكن أن تجد أي ارتباط بين النمط الجيني وتواتر حدوث الصفات المظهرية مثل العمى، والسمنة، وارتفاع ضغط الدم، أو مرض السكري (18). هم افترض أنه بسبب هذا عدم وجود علاقة، ويشارك جميع الجينات BBS في عملية الخلوية متطابقة. ومما يعزز هذه الفرضية من قبل عدة ملاحظات: (1) colocalization من البروتينات المختلفة BBS على مستوى أهداب الابتدائي والجسيم المركزي. (2) وصف الأخير ل-مجمع الأساسية للبروتينات BBS، وBBSome (3)؛ (3) التشابه من الظواهر التي لوحظت في نماذج الماوس BBS، أيا كان الجين تتم إزالة (5). ومع ذلك، في هذه السلسلة، الاختلافات المظهرية لاحظنا يبدو أن تحدث وفقا للتحولات التي تنطوي إما على الجينات امتلاك إلى BBSome أو الجينات الأخرى من مثل chaperonin-مجموعة البروتينات الفقاريات محددة (BBS6، BBS10، وBBS12). يبدو أن المرضى الذين يعانون من الطفرات في الجينات الأخيرة أن يكون النمط الظاهري الكلوي أكثر حدة مقارنة مع المرضى الذين يعانون من الطفرات في BBSome. ويؤيد هذه الفرضية من خلال دراسة حديثة فيها إزالة هذه الجينات في الصدارة الزرد إلى النمط الظاهري أكثر شدة بطريقة تعاونية (4). وتوضح النتائج المعروضة على أهمية إجراء المزيد من الدراسات لفهم أفضل BBS على المستوى الجزيئي، وكذلك علم الأوبئة الوراثية لها.
ومن الواضح أن هذه الدراسة لديها بعض القيود. كما ذكر سابقا، أجرينا دراسة مستعرضة في عدد السكان من المرضى الصغار مع BBS. وكان جميع المرضى في مرحلة مبكرة من المرض، وهناك حاجة إلى المسح الطولي للتأكيد على أهمية النذير عوامل خطر عالية القلب والأوعية الدموية والكلى. BBS1 من خلال الجينات BBS12 تم فحص شامل للطفرات ولكن يجري حاليا التحقيق BBS13 وBBS14.
وفي الختام، فإن هذه الدراسة تسلط الضوء على ارتفاع معدل انتشار المرض الكلوي في BBS وتؤكد على ضرورة التشخيص المبكر والعلاج. تحتاج عوامل الخطر القلبية الوعائية للنظر، وإذا كان موجودا، وتعامل في وقت مبكر لمنع المضاعفات اللاحقة. قد تكشف الدراسات التنميط الجيني في المستقبل واسعة الارتباط الوراثي، النمط الظاهري، مما يسمح التشخيص المبكر وتحسين فهم الفيزيولوجيا المرضية من تشوهات القلب والأوعية الدموية المرتبطة بها. سوف دراسة طولية من المرضى المقدمة في هذه الوثيقة توفر بيانات قيمة على المراضة والوفيات، والتطور الطبيعي للمشاركة أمراض القلب والكلى. على الرغم من BBS هو اضطراب نادر، فإنه من مصلحة كبرى لأمراض الكلى كتعيين الوراثي والجزيئي سيسهم في الفهم العام للciliopathies الكلى الموروثة، ومشاكل القلب والأوعية الدموية في الفشل الكلوي المزمن. وبالتالي، فإن دور أمراض الكلى هو محوري في إدارة هذه المتلازمة المتعددة لليؤثر على القلب والأوعية الدموية ونظم الكلى.

رافت ابراهيم 11-23-2015 08:11 PM

فقدان بارديه-بيدل البروتينات يسبب متلازمة خلل في تعصيب الحسي المحيطي وظيفة

ستقبال وتفسير المحفزات البيئية هو أمر حاسم لبقاء جميع الكائنات الحية. هنا، وتبين لنا أن الاجتثاث من BBS1 وBBS4، اثنين من الجينات الطافرة في متلازمة بارديه-بيدل وأن البروتينات ترميز أن توطين بالقرب من centrioles من الخلايا العصبية الحسية، يؤدي إلى تغيرات في تعصيب الحسي SC والاتجار في TRPV1 قناة thermosensory وميكانيكية حسية قناة STOML3، مع ما يصاحب ذلك من العيوب في thermosensation الطرفية وmechanosensation. ولخص النمط الظاهري thermosensory في ايليجانس انواع معينة، لأن ردود thermosensory نقص المسوخ BBS اضح في كل من درجات الحرارة الفسيولوجية ومسبب للألم وخلل الاتجار OSM-9، وهو بروتين قناة الحسي polymodal وhomolog الوظيفي للTRPV1 أو TRPV4. وتشير النتائج التي توصلنا إليها وغير معترف بها حتى الآن، ولكن من الضروري، دور الثدييات بروتينات الجسم القاعدية في الحصول على المحفزات mechano- وthermosensory وتسليط الضوء على الميزات يحتمل السريرية للciliopathies في البشر.
كشفت دراسة الحواس في كل من الفقاريات واللافقاريات دور للأهداب في chemosensation، mechanosensation، وphotosensation. في ذبابة الفاكهة، chemosensation وmechanosensation تعتمد بشكل خاص على الخلايا العصبية التي مهدبة (1). وبالمثل، راسخة دور للأهداب في chemosensation في ايليجانس انواع معينة، حيث المسوخ مع وظيفة للخطر أو هيكل من العيوب عرض أهداب في الاستشعار عن عطر أو الاختلافات في الأسمولية (+2 - 4). في الثدييات، مستقبلات الرائحة توطين لأهداب الشم (5)، وأجهزة phototransduction الخلايا قضيب ومخروط في الفقاريات يموضع إلى الجزء الخارجي، وهدب المعدلة (6). وأخيرا، فإن الهدب المحرك شرط أساسي للتنمية القوقعة، وبالتالي السمع بسبب دورها في stereociliary التشكل حزمة (7).
نحن وغيرنا قد أظهرت أن الخسارة من وظيفة الطفرات في الجينات الكامنة وراء عديد المظاهر بارديه-بيدل النمط الظاهري (8) تسبب العجز الحسية التي تشمل فقدان الرؤية، الشم، السمع ومعيب (5، 10). جميع البروتينات BBS تتسم حتى الآن توطين بالقرب أو داخل الهيئات القاعدية وأهداب في كل خلايا الثدييات (11 - 13) وفي C. ايليجانس الخلايا العصبية الحسية (+14 - 16).
هنا، وتبين لنا أن الثدييات الخلايا العصبية الحسية المحيطية ومهدبة وأن المسوخ الماوس مع المستهدفة الخسارة من وظيفة الطفرات في أي Bbs1 أو Bbs4 المعرض thermosensory الظواهر التي تتميز زيادات كبيرة في الإختفاء استجابة سلوكية. من غير المرجح أن يكون سبب العليا القشرية أو اختلال وظيفي محرك هذه العيوب ولكن ترافقها تغيرات في تعصيب الحسي الجلدي وخلل توزيع الجزيئات المستجيب في سوما الخلايا العصبية الحسية. هذه الظواهر ليست فريدة من نوعها للثدييات، لأن BBS الخيطية المسوخ هي أيضا thermosensory معيب. وأخيرا، والبشر مع BBS أيضا البيان بعض أعراض مشابهة لتلك التي لوحظت في الفئران، مثل انخفاض درجة الحرارة والاهتزاز الإحساس. وتشير دراساتنا دورا حاسما من الجسم الهدبي والقاعدية البروتينات عن وظيفة الثدييات الخلايا العصبية الحسية الطرفية وتنبيغ كفاءة من المحفزات extraorganismal.

الظهرية جذر العقد هي مهدبة.

في الثدييات، وقد لوحظ أهداب الابتدائي في معظم الخلايا تالية للتفتل. ومع ذلك، فإنها لم يتم الإبلاغ عنها في الخلايا العصبية الحسية الطرفية. وبالنظر إلى أن أهداب الابتدائية أداء المهام الحيوية في الخلايا العصبية الحسية اللافقارية، ونحن التحقيق ما إذا كانت هذه الخلايا يمكن أيضا المهدبة في الثدييات. تلطيخ العقد الجذرية الظهرية (DRG) المقاطع مع الأجسام المضادة ضد IFT88 البروتين axonemal (بولاريس) (17 اقترح) وجود أهداب (لا تظهر البيانات)، الذي كان مدعوما من جراء انتقال المجهر الإلكتروني (الشكل 1 A، F، وG). لتحقيق هذا الاحتمال أكثر شمولا، وخصوصا بسبب أقسام DRG تحتوي على السكان غير متجانسة من أنواع الخلايا، ونحن مثقف الخلايا العصبية DRG من الفئران البالغة WT وخلايا ملطخة أجسام مضادة ضد سلسلة من البروتينات axonemal المعروفة ومكافحة NeuN لتمييز الخلايا العصبية من أنواع الخلايا الأخرى . لاحظنا تلطيخ محددة على طول أهداب الخلايا العصبية لIFT88 (الشكل 1 B)، وكذلك IFT57 (لا تظهر البيانات). لنؤكد أيضا أن هذه ليست قطعة أثرية عبر التفاعل، ونحن transfected الثقافات DRG مع ترميز البلازميد و(V5) البروتين الموسومة حاتمة axonemal، IFT81 (18). Costaining مع الأجسام المضادة وحيدة النسيلة المضادة للV5، وكذلك المرتبطة أنيبيب بروتين 2 (MAP2؛ الشكل 1 C)، علامة الجذعية العصبية، أيد كذلك وجود هدب على سوما الخلايا العصبية DRG.
تين. 1.
الخلايا العصبية DRG لها أهداب الابتدائي. (A،G و) الفئران DRGs الموافق قطني المناطق تم تشريح L3-L5 وتعرض لالمجهر الإلكتروني. التكبير، × 60000 (يسار)؛ × 8000 (مركز)؛ × 15000 (يمين). كانت تزرع (B و C) DRGs الفئران فصل، في الثقافة لمدة 3-7 أيام، تليها مناعية باستخدام علامة النقل intraflagellar بولاريس (IFT88) (B) جنبا إلى جنب مع علامة العصبية NeuN. كانت ملطخة A 72-ح ترنسفكأيشن من IFT81 الموسومة ب V5 أيضا مع الأجسام المضادة لمكافحة V5 وMAP2 (C)، علامة الجذعية. تشير الأسهم الصفراء للأهداب. عرض (أقحم) التكبير من هدب تلطيخ الخلايا العصبية. (D و E) سيتولوجية مناعية من الخلايا العصبية DRG مثقف مع الأجسام المضادة ضد BBS1 (D) وBBS4 (E)، costained مع علامة العصبية NeuN. السهام الخضراء تشير إلى إيجابي توطين الجسم القاعدية.
الفئران BBS المسخ وقد حراري وميكانيكية حسية المعيبة الظواهر.

وقد ارتبطت طفرات فارغة في البروتينات BBS مع عيوب وظيفية، ولكن ليس الهيكلية، من هدب سواء بصورة مباشرة، كما يتضح من تنكس الشبكية (9، 10) والشم (5)، وبشكل غير مباشر، من خلال نقل عيب محتمل للإشارة WNT (7). لذا تساءلنا عما إذا كان وجود أهداب في الخلايا العصبية الحسية التي يعصب الجلد قد تؤكد أخرى، تأخذ حقها حتى الآن، والعجز الحسي في المسوخ ciliopathy.
أولا، لإقامة وجود هدب في DRGs من BBS فئرانا معدلة وراثيا، أجرينا مناعية على DRGs فصلها نمت في الثقافة التي تم الحصول عليها من Bbs1 - / - وBbs4 - / - الفئران. Costaining مع أي أدينيليل محلقة 3 (AC3) أو أظهر IFT88 وNeuN أهداب العادي بشكل صارخ في كل من سلالات متحولة [المعلومات الداعمة (SI) الشكل. 6 A]، في حين أن توزيع γ تويولين كان تمييزه عن الضوابط WT، مما يشير إلى أن العمارة الإجمالية من الجسم القاعدية هي أيضا طبيعية (SI الشكل 6 B). ثم لإنشاء توزيع البروتينات في الخلايا العصبية DRG BBS، أجرينا مناعية على DRGs فصلها من فئران بالغة. والجدير بالذكر أن هذه الخلايا العصبية تبدي الهيئات القاعدية التي هي منفصلة مكانيا من centrosomes، وكما يتضح من تلطيخ مع MAP-2 و γ تويولين (19) (SI الشكل 6 B)، وهو نمط تذكرنا IMCD3 خلايا القناة جمع الكلوي (11) ربما كان هذا هو انعكاس للدولة تالية للتفتل الاستقطاب من هذه الخلايا. وكان توزيع البروتينات BBS في WT أيضا مطابقة للأنماط المحددة سابقا في هذه الخلايا (+11 - 13)، مع كل من BBS1 وBBS4 توطين بالقرب centrosomal منفصلة أزواج (محيط بالمريكز أو مريكزي) من النقاط في كل عصبون (الشكل 1 D وE).
ونظرا لهذه الملاحظات، أجرينا فحوصات السلوكية على Bbs1 - / - الفئران كوسيلة أولية لاستكشاف دور (ق) من هذه البروتينات في وظيفة الخلايا العصبية الحسية. وكان أول اختبار الغمر فحص الذيل، الذي قمنا بقياس الكمون الانسحاب ذيل عبر مجموعة من درجات الحرارة. في مجموعة من التجارب أجريت في ثلاث نسخ والطرف عن التركيب الوراثي، وجدنا أن Bbs1 - / - كان المسوخ يعد الإختفاء مقارنة مع تتزاحم WT، مما يشير إلى أن هذا المسخ كان له المعيبة، ولكن لا تضيع والاستجابة thermosensory (الشكل 2. أ) .
تين. 2.
Bbs1 - / - الفئران لها ردود ناقصة للمؤثرات الحرارية والميكانيكية وكذلك تقليل نقل الإشارة إلى الحبل الشوكي ردا على التحفيز الحراري. (A) نتائج من فحص ذيل الغمر التي المستمر التحفيز في 46 ° C، +48 ° C، 50 درجة مئوية، أو 52 ° C يطبق، ويتم تسجيل الوقت للرد. عموما، Bbs1 - / - فى الحيوانات الإختفاء أكبر من نظرائهم WT. (ب) فحص فون فراي على Bbs1 - / - أظهرت الفئران قدرا أكبر من القوة اللازمة للحث على الاستجابة الميكانيكية مقارنة مع WT. (C) أقسام التمثيلية للL3 / L4 / L5 الظهرية منطقة القرن Bbs1 + / + وBbs1 - / - الفئران ملطخة المضادة للج-FOS بعد التحفيز من واحد مخلب هند في 48 ° C أو 52 ° C حمام الماء . (D) قطعة أرض لعدد من ج-فو نوى -positive في القرن الظهري المماثل مقابل القرن الظهري المقابل بعد التحفيز من واحد مخلب هند في 48 ° C أو 52 ° C حمام الماء = 4 الفئران في التركيب الوراثي). (التكبير، × 10).

تساءلنا المقبل ما إذا كانت هذه المسوخ قد يكون أيضا العيوب الحسية الأخرى. وبالتالي فإننا اختبار لنقص محتمل في mechanoception مع اختبار فون فراي، الذي وكميا الحواس من حيث استجابة لضغوط عبر مجموعة من القوى الميكانيكية التطبيقية. وجدنا أن Bbs1 - / - فى الحيوانات عتبة استجابة انخفضت إلى نقط المحفزات تطبيقها على قوات أقل مقارنة مع الفئران WT (الشكل 2 B). الأهم من ذلك، لم يكونوا على thermosensory ولا الظواهر ميكانيكية حسية فريدة من نوعها لBbs1 - / - الفئران، لأن التحاليل متطابقة من Bbs4 - / - كشفت المسوخ نفس العيوب (لا تظهر البيانات).
لتفسير هذه الظواهر، رأيناها ثلاثة احتمالات: أن الحيوانات كانت الاستجابات الحركية المعيبة، أن الحيوانات قد يثير الشبهة أعلى وظيفة القشرية وبالتالي فقد تحدت لتفسير الإشارات الحسية. أو أن العيب نشأ في تعصيب لها الطرفية. كما استبعدت الاحتمال الأول عن طريق اختبار التنسيق الحركي مع rotarod متسارع. على الرغم من أن بعض المسوخ BBS كانت أثقل من تتزاحم WT، وعدم وجود فروق ذات دلالة إحصائية بين Bbs1 - / - الفئران وWT عبر أربع التجارب التي أجريت أعمى إلى التركيب الوراثي (P = 0.13؛ SI الشكل 7.).
المقبل، للتمييز بين العيوب الطرفية وتشوهات في أعلى وظيفة القشرية، درسنا قراءات thermosensory دون مستوى الدماغ، وهي الاستقراء أثار حرارة فوري الجيني المبكر ج-فو في الدرجة الثانية الخلايا العصبية الحسية من النخاع الشوكي القرن الظهري (20). A تخفيض يسببها حراريا ج-فو في القرن الظهري، كما تم قياسها عن طريق حساب عدد من نوى ج-فو-إيجابية، تشير إلى أن وجود خلل ما لا يقل يحدث في تعصيب الطرفية أو تفعيل الخلايا العصبية من الدرجة الثانية. إذا يبقى ج-فو الاستقراء العادي في القرن الظهري، ثم عيب يمكن أن تحدث في مراكز المعالجة CNS أعلى (20). نحن حفز مخلب واحد من ثلاثة المسوخ وثلاثة تتزاحم WT إما في 48 ° C أو 52 ° C وكميا النووي التعبير ج-فو في القرن الظهري المماثل عبر المقاطع المسلسل الى منطقة أسفل الظهر (L3-L5)، أعمى إلى التركيب الوراثي. وعلى النقيض من تفعيل قوي من الظهرية الخلايا العصبية قرن في الحيوانات WT تتعرض ل48 ° C التحفيز، لاحظنا تفعيل ضئيلة أو معدومة من ج-فو في الخلايا العصبية القرن الظهري المسوخ Bbs1 "في نفس درجة الحرارة (الشكل 2 C و D). ظلت استجابة من المسوخ والحيوانات WT مختلفة إلى حد كبير عند 52 ° C، على الرغم من درجة الحرارة هذه، المسوخ تظهر بعض الاستجابة، مما يشير إلى وجود الشذوذ الحسي المحيطي.
العيوب التشريحية في التعصيب الشوري في الفئران BBS المسخ.

لتحديد ما إذا كانت التغيرات في الغدد العرقية الطرفية قد تساهم في العجز الحسي المرصودة، قمنا بتحليل المشعر هند مخلب (GHP) أقسام الجلد immunolabeled لPGP 9.5، علامة panneuronal، وCGRP، علامة من تعصيب ببتيدي المفعول (الشكل 3، SI الجدول 2 ). وكشف التحليل النوعي تخفيضات في CGRP مناعية (IR) بين ألياف داخل الجلد الحلمية كل المسوخ BBS (الشكل 3 أ و ب). كريات ميسنر، التي تعبر عادة عن انخفاض مستويات CGRP-IR (21)، لم تتأثر بشكل ملحوظ. تم تغيير توزيع النهايات الحسية داخل البشرة وحجم الجلد الحلمية أيضا في كل من المسوخ BBS. في منصات WT، تعصيب لديه توزيع موحد نسبيا في جميع أنحاء البشرة بينما في المسوخ BBS، فهي تتركز بشكل غير متناسب في الجلد الحليمات (الشكل 3 C). الكمي التي أجريت على GHP الأنسجة المسمى لPGP 9.5 والفأر مكافحة Cy2 لترسيم الحدود بين الجلد ابيديرمي epidermal أكد أن كلا من المسوخ BBS زادت النهايات الحسية أعلاه وعلى الحدود بين الحليمات، والتي كانت أيضا أوسع من WT (الشكل 3 F وH). لم يتم تغيير كثافة البشرة إنهاء الشاملة عبر لوحة بالكامل انخفض بدرجة كبيرة في أي من المسوخ BBS.
تين. 3.
الاختلافات في بنية البشرة والغدد العرقية في BBS - / - الفئران. (A و B) صور منصات البعيدة من الكفوف الخلفيتين المشعر تظهر CGRP (الحمراء) مع PGP (الأخضر) (A) وCGRP (B) immunolabeling وحده BBS - / - قد الحيوانات خفضت مناعية CGRP في الألياف العصبية داخل الجلد الحليمات ( الأسهم الصفراء)، في حين لم تكن هناك اختلافات واضحة في نسبة-CGRP إيجابي النهايات البشرة (النجوم الصفراء). الأسهم الخضراء والنجوم تشير ألياف الجلد العصبي PGP الإيجابي والنهايات البشرة، على التوالي. يشار إلى الحدود البشرة الجلدية خط متقطع. (C) الصور من منصات البعيدة من WT وBBS - / - الفئران المسمى لPGP 9.5. ومتباعدة تعصيب بالتساوي في جميع أنحاء البشرة لوحة WT ولكنها تتركز في الحليمات الجلدية في المسوخ BBS. (D) عن قرب من منطقة لوحة البعيدة اختيارها يدل على تصنيف شخصي من النهايات الحسية على أساس موقفهم في البشرة قريبة الحليمات الجلدية (بين أعلاه، أو على الحدود بين حليمة). وصفت النهايات التي تغطي مناطق متعددة في كل منطقة مروا من خلال (على سبيل المثال، النهايات interpapilla الحدود). (E) صور منصات البعيدة المسمى مع مكافحة فأر Cy2 لترسيم الحدود بين الجلد ابيديرمي epidermal تبين أن المسوخ BBS لها كبير، شوه الحليمات الجلدية (السهام البيضاء). الحليمات (خطوط بيضاء صلبة) والأمثلة على المناطق تحديدها بشكل غير موضوعي أعلاه (تبددت خطوط بيضاء) وعلى الحدود بين حليمة (منقط خطوط بيضاء) وتتبع. (F-H) الكمي لتعصيب البشرة وهيكل حليمة الجلد أجريت على أقسام الأنسجة المسمى مع PGP 9.5 والفأر مكافحة Cy2. (F) كل BBS - / - المسوخ كان أكثر بكثير النهايات أعلاه وعلى الحدود بين الحليمات مقارنة مع WT، وBbs1 - / - الفئران كان أكثر بكثير مجموع النهايات الحليمات من Bbs4 - / - الفئران. وبلغ مجموع النهايات الحليمات مجموع كل النهايات التي مرت عبر المناطق المذكورة أعلاه أو على الحدود بين الحليمات. (G) Bbs1 - / - زيارتها الفئران كثافة أكبر بكثير من النهايات فوق الحلمية الخاصة بهم، وBbs4 - / - زيارتها الفئران أقل بكثير النهايات بين الحليمات بهم، مشيرا إلى أن عددا أكبر من النهايات المرتبطة الحليمات في هذه الحيوانات لم يكن بسبب مجرد التغيرات في حجم الحليمات. لا توجد فروق ذات دلالة إحصائية لإنهاء الكثافة خارج المنطقة الحلمية (من بداية ونهاية لوحة لحليمة الأولى) أو على لوحة كاملة. حسبت البشرة الكثافة إنهاء بقسمة عدد من النهايات في المنطقة من خلال طوله. كان المسوخ (H) كل من BBS لفترة أطول كثيرا الحليمات الاعراض لكن ليس المرتفعات. وقد تم قياس ارتفاع حليمة من قاعدتها المقدرة على الارتفاع ذروته في البشرة، وحسبت عرض بتقسيم منطقة الحليمة التي كتبها ذروتها. موانئ دبي، حليمة الجلد، سان جرمان، الغدد العرقية. ه، البشرة. د، الأدمة.
C. ايليجانس BBS المسوخ هل Thermosensory المعيبة.

على الرغم من أن البيانات الثدييات دينا أنشأت الظواهر thermodefective عن المسوخ لدينا، تعصيب الثدييات معقدة بطبيعتها، ويمكن أن الظواهر الحسية تكون متغيرة. علاوة على ذلك، الخلايا العصبية الحسية الثدييات أيضا التفاعلات المعقدة مع أنواع الخلايا الأخرى التي مهدبة أيضا، مثل خلايا شوان والخلايا الكيراتينية (22، 23). لهذه الأسباب، لجأنا إلى كائن مهدبة بساطة، C. ايليجانس، حيث يمكننا أن التحقيق في عواقب القاعدية ضعف الجسم / الهدبية في thermosensory استجابة حصرا في الخلايا العصبية الحسية المهدبة.
لاختبار الدور المحتمل للC. البروتينات ايليجانس BBS في thermosensation، ونحن أول مقارنة سلوك اثنين وصفت سابقا BBS المسوخ (14)، (المعروف أيضا باسم OSM-12) BBS-7 و BBS-8، مع أن من نظرائهم WT في مقايسة تكيف حراري (24) . عند وضعه على التدرج الحراري الطولي الضحلة تتراوح ما بين 18.5 درجة مئوية إلى 21.5 درجة مئوية (في 8 سم)، انتقلت الحيوانات WT بشكل فعال في درجة الحرارة تربية الخاصة من 20 درجة مئوية خلال مدة 1 ساعة (الشكل 4 A). على النقيض من ذلك، BBS-7 و BBS-8 المسوخ عرض عيوب كبيرة إحصائيا (P <0.00001) في تكيف حراري لمنطقة C 20 ° (الشكل 4 A). وقد أجريت على عدد متساو من تكيف حراري فحوصات عن طريق وضع الحيوانات على الجانب الساخن أو البارد من بلاطة آغار، وضمنا النتائج التي المسوخ الهدبية كانت معيبة في thermosensation العام، تبين عدم وجود تفضيل لدرجات حرارة دافئة أو باردة. لا يمكن أن يعزى هذا النمط الظاهري لالحركي العيوب، لأن عرض حركة الحيوانات متحولة (أي الانحناءات في الدقيقة) لا يمكن تمييزها من WT (لا تظهر البيانات). بالإضافة إلى ذلك، أظهرت BBS-7 و BBS-8 سلالات متحولة انقاذ مع الجينات WT كل منها استعادة تكيف حراري السلوكيات (الشكل 4. A؛ BBS-7 الإنقاذ = 0.5307 ± 0.073؛ BBS-8 الإنقاذ = 0.4925 ± 0.063). الأهم من ذلك، وهذه العيوب لا يقتصر على المسوخ BBS، لأن المسوخ الهدبية الأخرى، بما في ذلك OSM-5، والتي بترميز ortholog من IFT52 (25)، وOSM-3، الذي يشفر كينيسين homodimeric اللازمة لبناء الجزء الأعلى من C . ايليجانس أهداب (26)، عرض أيضا تكيف حراري العيوب (P <0.00001) التي كانت قابلة للمقارنة مع تلك التي BBS المسوخ (الشكل 4 A). أيضا من الفائدة، كان التشكل العام للتزيين زغيبات AFD thermosensory الخلايا العصبية هدب سليمة، مما يوحي بأن العيوب فقط في هدب الأساسي تسببت في النمط الظاهري (لا تظهر البيانات).
تين. 4.
C. ايليجانس تظهر طفرات الهدبية تكيف حراري والعيوب تجنب الحرارية وكذلك mislocalized OSM-9. (A) تكيف حراري وتجنب الحراري للWT (N2)، BBS المسوخ، وOSM-3 كينيسين المسوخ. تكيف حراري يتصل جيدا كيف تتحرك الديدان لمن منطقة درجة الحرارة تربية (20 ° C). (B) تجنب Nonthermal هي نسبة الديدان التي لا تجنب درجات الحرارة الضارة قدم بالقرب من رأس الحيوان. لA و B، *، P <0.00001. (C) GFP الموسومة OSM-9 mislocalizes في BBS-8 الحيوانات متحولة. TZ، منطقة انتقالية / الجسم القاعدية. *، تراكمات غير طبيعية لم تشهدها من النوع البري الحيوانات.

المقبل، لاختبار ما إذا كانت العيوب thermosensory تمتد إلى درجات الحرارة الضارة، أجرينا فحص تجنب الحراري، والتي تم قياس استجابة الديدان الفردية إلى درجة حرارة مسبب للألم (≈50 ° C) وضعها مباشرة في مسار حركتهم قرب رؤوسهم ( 27). الحيوانات WT (ن> 400) تتوقف حركتها إلى الأمام وبدء متميزة، عكس انعكاسية استنساخه في 94.9٪ من الحالات (الشكل 4. انظر أيضا المرجع 27). على النقيض من ذلك، BBS-7 و BBS-8 المسوخ (ن> 400) على حد سواء أظهر الظواهر تجنب الفقيرة (P <0.00001)، مع تجنب الاستجابات المناسبة لوحظ في فقط 73.1٪ و 73.3٪ من الحالات، على التوالي. وبالمثل، عرض على OSM-3 وOSM-5 المسوخ تجنب في 78.3٪ و 73.4٪ من الحالات (P <0.00001)، على التوالي (الشكل 4 A). للتأكد من أن الظواهر التي تعاني من نقص الحرارية على وجه التحديد بسبب طفرات في BBS، أكدنا أن BBS-7 و BBS-8 المسوخ التعبير عن الجينات المحورة WT كانوا قد الردود تجنب الحرارية مقارنة مع تلك الحيوانات WT (BBS-7 الإنقاذ = 95.0٪ ± 3.2 ٪، BBS-8 الإنقاذ = 94.5٪ ± 0.4٪، الشكل 4 B).
سعينا المقبل لمواصلة التحقيق الأساس الكيميائي الحيوي لهذا النمط الظاهري. وكان أحد الاحتمالات أن وظيفة الهدبية المعيبة قد التشويش على حركة الجزيئات المستجيب، منها مستقبلات TRP سيمثل المرشحين المثالي. ولذلك درسنا حركة OSM-9 في المسوخ لدينا. لأنه لا يوجد C. وحتى الآن تم ربط قناة ايليجانس TRP خصيصا لthermosensation، ركزنا على OSM-9، وهو بروتين axonemal يعرف ما هو مطلوب لالكيميائي ويمثل homolog الوظيفي المحتمل للTRPV1 الثدييات أو TRPV4 (28، 29). وجدنا أن إصدار GFP الموسومة من OSM-9، والذي يموضع بشكل صحيح إلى الخيط المحوري الهدبية في الحيوانات WT، يظهر mislocalization متغير ولكن ثابت في خلفية BBS متحولة. على وجه التحديد، عرض BBS-8 الحيوانات تراكمات / mislocalization لم أر في الحيوانات WT أو في BBS-8 الحيوانات الإنقاذ، على طول التغصنات، داخل أو على مقربة من الجسم القاعدية، وعلى طول الخيط المحوري الهدبية (الشكل 4 C). على الرغم من أن OSM-9 ليس C. ايليجانس thermosensory مستقبلات في حد ذاته، وتشير النتائج التي توصلنا إليها أن التفسير الجزيئي واحدة على الأقل في النمط الظاهري thermosensory هو أن جهاز thermosensory القائم على هدب (على سبيل المثال، TRP-نوع مستقبلات) mislocalizes أو غير فعال عندما تتعطل BBS ظيفة البروتين.
عيب توزيع مستقبلات الخلايا العصبية في الفئران DRG.

على الرغم من أن تشريح C. ايليجانس الخلايا العصبية الحسية تختلف بشكل ملحوظ عن تلك الخلايا العصبية الحسية الطرفية في الثدييات (لأسباب ليس أقلها الموقف من هدب النسبي لموقع المدخلات الحسية)، أثارت بيانات دينا إمكانية المتميزة التي mistrafficking أو misregulation من حراري والبروتينات قناة ميكانيكية حسية قد تسهم في الظواهر التي لوحظت في الماوس. لدراسة هذا الاحتمال، ركزنا على TRPV1 مستقبلات الثدييات، ينشط في نطاق حيث لوحظ أن النمط الظاهري في المقام الأول (30) وSTOML3، وهو بروتين مثل stomatin أن ثبت مؤخرا أنها ضرورية لmechanosensation (31)، والتي لقد وجدنا سابقا أن mislocalized في الظهارة الشمية من BBS المسوخ الماوس (5).
نحن تقييمها أولا توزيع TRPV1 في أقسام GHP من كل بلد من بلداننا المسوخ وتتزاحم WT. نحن لم نلاحظ أي اختلافات ملحوظة بين تلطيخ النهايات (لا تظهر البيانات). ومع ذلك، عند اختبار مقصورة آخر من هذه الخلايا العصبية، ونحن لم نلاحظ تغير TRPV1 مناعية في سوما على النحو الذي يحدده التهديف أعمى من أقسام متتالية عبر DRG. أربعة من ستة Bbs1 - / - الحيوانات قد الاكتئاب إشارة TRPV1 كما تقرره متوسط ​​كثافة الخلايا العصبية الملون بشكل إيجابي، في حين أن Bbs4 - / - أظهرت الحيوانات زيادة في كثافة-TRPV1 إيجابي somata (SI الشكل 8 A و B.). كان هذا يذكرنا العيوب وحظ سابقا من الخلايا العصبية الشمية، حيث Bbs1 - / - وBbs4 - / - أظهرت الحيوانات الظواهر الخلوية متناقضة، وكلاهما توج في نفس الخلل الوظيفي (32). نحن لا نعرف ما إذا كان هذا الاكتشاف يعكس مواصفات العصبية غير الطبيعية (يحتمل أن تكون نتيجة لهدب عيب) أو ما إذا كان أقلقت الاتجار مستقبلات.
وجدنا اضطرابات مماثلة في توزيع STOML3. في حين تم الكشف عن كميات متواضعة في السيتوبلازم (وربما غشاء البلازما) من الخلايا في الفروع عبر DRG في الحيوانات WT، لاحظنا وضوحا تراكم STOML3 في نوى على حد سواء Bbs1 - / - وBbs4 - / - الحيوانات (الشكل 5 )، والتنبؤية توزيع عيب ميكانيكية حسية.
تين. 5.
توزيع STOML3 في الخلايا العصبية DRG. وعلى النقيض من الحيوانات WT، وزعزع STOML3 تلطيخ في المسوخ BBS، حيث يبدو أن mistrafficked إلى النواة. الصور هي في التكبير، × 40.
العيوب الحسية في BBS المرضى.

إنشاء thermosensory المعيبة / ردود مسبب للألم في الجسم الهدبي والقاعدية المسوخ في الماوس وC. أثار ايليجانس إمكانية واضحة أن المرضى BBS قد أيضا يحمل أوجه القصور الحسية غير معروف حتى الآن. لاختبار هذه الفرضية مباشرة، قمنا بتعيين تسعة مرضى BBS لا علاقة لها فوق سن ال 17، وبناء على موافقة مستنيرة، يعاير عليهم سبع لطرائق الحسية باستخدام اختبار عصبي القياسية. كان جميع المرضى تناقص ملحوظ في قدرتها على كشف الاهتزاز عندما تم تطبيق الشوكة إلى اللقم الإنسي والجانبية على ظهر المعصم وكل عرض الفقراء التمييز بفارق نقطتين على النخيل وظهر اليد. سبعة من التسعة (78٪) لديهم الحس العميق تضاءلت (الشعور موقف مشترك)، وأربعة من تسعة (44٪) قد تضاءلت حساسية درجة الحرارة، وسبعة من تسعة (78٪) لم يتمكنوا من تحديد دقيق لوزن أو شكل الجسم وضعها في كف (الجدول 1).

الجدول 1.
الظواهر الحسية في المرضى الذين لا علاقة BBS


هنا، لقد أظهرنا أن somata من الخلايا العصبية الحسية الثدييات ومهدبة وأن الخسارة من وظيفة الطفرات في الهدبية والبروتينات الجسم القاعدية تؤثر على وظيفة هذه الخلايا، التي تترجم إلى عيوب في تصور thermosensation في الماوس، واسعة الظواهر الحسية لدى البشر. على حد علمنا، هذا الارتباط في الثدييات بين الجسم القاعدية / البروتينات الهدبية وthermosensation هي غير المبلغ عنها سابقا، ويحتمل أن تكون لها آثار كبيرة على فهمنا لتطور وظيفة الخلايا العصبية الحسية الطرفية.
على الرغم من أن الأساس الخلوي الدقيق لهذا النمط الظاهري سوف تحتاج إلى مزيد من التحقيق، وتشير البيانات المتوفرة لدينا أن اضطراب الجسم القاعدية يمكن ربما يؤدي إلى mislocalization يصاحب ذلك من TRPV1 وSTOML3 في العقد الجذرية الظهرية، ملمحا إلى أن الاتجار معيب والتعبير، أو توطين الخلوية من هذه القناة البروتينات، أو في الواقع مواصفات العصبية، قد تساهم في الظواهر المرصودة. اكتشافنا أن C. ايليجانس OSM-9 جزئيا mislocalizes في BBS المسوخ تدعم هذه الفرضية. يتسق أيضا مع نموذج النقل، وأشارت بيانات حديثة أن PKD2 heterodimerizes مع واحد على الأقل من قنوات thermoTRP، TRPV4، ويبدو أن هناك حاجة لوظيفة الصحيحة لها (M. Köttgen وG. والز، اتصال شخصي)، وتقدم ميكانيكي الصلة بين البروتينات الهدبية والعجز thermosensory. ومع ذلك، العيوب التخلق إضافية قد تسهم أيضا، كما يتضح من تعصيب الجلدي الشاذة من كل من المسوخ ciliopathy فحصها. تم ترجمة مستقبلات مثل SSTR3 و 5 HT6 لأهداب الابتدائي الخلايا العصبية في الدماغ (33، 34)، وعلى الرغم من أنها لم أظهر في DRG أهداب، وأعربت SSTR3 مرنا في الخلايا DRG (35). ومن الملاحظ أيضا أن بعض الناقلات العصبية ونيوروببتيد ويعتقد أن يصدر من سوما DRG (36، 37). أخذت معا، هذه الملاحظات تؤدي بنا إلى التكهن قد يكون متورطا أن أهداب DRG في العوامل الإنمائية الرئيسية الاستشعار، التي يمكن بدورها تنظيم توطين وظيفة تعصيب الحسي المحيطي.
في الوقت نفسه، فمن الممكن أن اختلال وظيفي الهدبي على الخلايا nonneuronal في محيط يمكن أن تسهم في هذه التغيرات في الغدد العرقية. على سبيل المثال، ومن المعروف أن الخلايا الكيراتينية أن مهدبة (22)، وكذلك خلايا شوان (23). وبالتالي يمكن لمزيج من العيوب الهدبية في كل من هذين النوعين من الخلايا يساهم في موقعنا thermosensory وحظ والظواهر ميكانيكية حسية. وبالتالي تكون هناك حاجة الاجتثاث المشروط من البروتينات الهدبية في الخلايا العصبية الحسية، طبقات الخلايا الكيراتينية منفصلة والخلايا الدبقية فضلا عن المسوخ الكبار محددة لتشريح المساهمة النسبية الزمانية المكانية لكل الأنسجة.
وأخيرا، تشير البيانات المتوفرة لدينا مريض BBS أن اضطراب الخلايا العصبية الحسية المحيطية قد لا تقتصر على thermosensation لكن قد عقد ينطبق أيضا على طرائق أخرى. وسيكون من المهم لتحديد مدى وطبيعة هذه العيوب، وما إذا كانت تقتصر على الجلد. في موازاة ذلك، فإنه من الأهمية بمكان لتحديد ما إذا كانت هذه الظواهر موجودة في متلازمات الهدبية أخرى. وقد أبرز الأعمال الأخيرة للciliopathies كمجموعة من الاضطرابات مع تداخل، وإن كان، الخصائص السريرية متغير مثل تنكس الشبكية وأمراض الكلى الكيسي، والشم (38). فمن المعقول أن نفترض أن العجز الحسي المحيطي قد تمثل بعد آخر، مكون underrecognized هذه الاضطرابات السريرية.

إجراءات تجريبية

الماوس السلوكية طرق التجريبية.

ذيل غمر الفحص.

تم مغمورة الثلث الأعلى من ذيل فأر في حمام الماء الساخن الذي عقد في 46 ° C، +48 ° C، 50 درجة مئوية، و 52 درجة مئوية. وكان مقدار الوقت اللازم لذيل الماوس للنقر على استجابة المسجلة. وضعت قطع مرات في كل درجة حرارة (1 دقيقة 46 ° C و 48 ° C، و 10 ثانية لمدة 50 ° C و 52 ° C) لمنع الضرر للحيوان. تم اختبار عشرة إلى 15 الفئران في التركيب الوراثي، وأجريت ثلاث تجارب في درجة الحرارة.

فون فراي الفحص.

وقد تأقلم الفئران لمدة 30 دقيقة على الأقل في غرف زجاجي قمة سلكية. تم تطبيق القوة الميكانيكية منقط إلى مخلب هند الصحيح باستخدام الإلكترونية فون فراي anesthesiometer (IITC، وودلاند هيلز، كاليفورنيا). كانت القوات التي انسحبت الحيوان مخلب الذي اتخذته ثلاث مرات حيث بلغ متوسط ​​الاستجابة. تم اختبار عشرة إلى 15 الفئران في التركيب الوراثي، وأجريت ثلاث تجارب.

فحص Rotarod.

وبدأ العمل في فترة التدريب حيث وضعت الفئران على rotarod تسريع (كولومبوس الآلات، كولومبوس، OH) بسرعة ثابتة من 4 دورة في الدقيقة لمدة خمس دقائق متتالية. إذا سقط الماوس، وضعت مرة أخرى على rotarod حتى 5 دقائق قد انقضت. ثم سمح الفئران للراحة في أقفاصها الفردية لا يقل عن 1 ساعة. تم الفئران ثم توضع مرة أخرى على rotarod في سرعة التعجيل من 4-40 دورة في الدقيقة مع التسارع التدريجي الذي يحدث كل 30 ثانية. وسجلت الوقت اللازم للماوس لتسقط على rotarod كرد. تم اختبار عشرة إلى 15 الفئران في التركيب الوراثي، وأجريت أربع تجارب.

الماوس تشريحية طرق التجريبية.

Immunolabeling من الماوس GHP أقسام الأنسجة باستخدام مكافحة PGP 9.5 (1: 800؛ Ultraclone) ومكافحة CGRP (1: 400؛ حدة طرفية مختبرات)، الأجسام المضادة الأولية مع المضادة للأرنب اليكسا فلور 488 (1: 500؛ المسابر الجزيئية)، ومكافحة -guinea pig Cy3 (1:500; Jackson ImmunoResearch) secondary antibodies was conducted as previously described ( 21 ).من أجل ترسيم واضح البشرة من الأدمة، ومكافحة فأر Cy2 (1: 250؛ جاكسون InnumoResearch) تم استخدام الأجسام المضادة الثانوية لتسمية المناعية الذاتية التي تتركز بشكل تفضيلي في الأدمة. كان إعداد الأنسجة من القرن الظهري DRG وفقا لبروتوكولات موحدة، كما تلطيخ وتقدير من الظواهر. للحصول على طرق مفصلة، ​​انظر طرق SI.

C. ايليجانس التحليلات.

جيل من الحيوانات والإنقاذ المعدلة وراثيا وكما وصفها (14). أجريت فحوصات السلوكية كما هو مفصل سابقا؛ لمزيد من التفاصيل التجريبية، انظر طرق SI.

رافت ابراهيم 11-23-2015 08:21 PM

التفاعل الجيني بين بارديه-بيدل الجينات متلازمة والآثار المترتبة على أطرافهم الزخرفة

متلازمة بارديه-بيدل (BBS) هو عديد المظاهر، واضطراب غير المتجانسة وراثيا تتميز البدانة، اعتلال الشبكية، polydactyly وضعف الإدراك، الكلى والتشوهات القلبية، فضلا عن ارتفاع ضغط الدم ومرض السكري. ومن المعروف أن الجينات متعددة لتسبب بشكل مستقل BBS. لا تظهر هذه الجينات إلى رمز لنفس الفئة الوظيفية للبروتينات. بعد، تحور كل النتائج في النمط الظاهري مماثلة. الجينات ضربة قاضية للجينات BBS المختلفة في الزرد تبين الظواهر المتداخلة لافت للنظر بما في ذلك النقل جسيم ميلانيني خلل واضطراب في الحويصلة المهدبة كوبفر. هنا، علينا أن نبرهن على ضربة قاضية الفردية bbs1 وbbs3 النتائج في نفس الظواهر نموذجية كما ذكرت سابقا للجينات BBS أخرى. نحن الاستفادة من نظام الزرد لتحديد ما إذا كانت شاملة في وقت واحد الزوج الحكيم ضربة قاضية للجينات BBS تكشف التفاعلات بين الجينات الوراثية BBS. باستخدام هذا النهج، علينا أن نظهر ثمانية التفاعلات الوراثية بين مجموعة فرعية من الجينات BBS. العلاقات التآزر بين مزيج متميز ليست بسبب التكرار وظيفية ولكن تشير تفاعلات معينة داخل مجمع BBS متعددة الوحيدات. بالإضافة إلى ذلك، نحن الاستفادة من النظام النموذجي الزرد للتحقيق في تنامي الأطراف. polydactyly البشري هو سمة أساسية من BBS لا يرد في نماذج BBS-الماوس. قمنا بتقييم الزرد زعنفة برعم الزخرفة و نظرن تغيير القنفذ الصوتي (SHH) التعبير وتغييرات لاحقة إلى fin عناصر الهيكل العظمي. تم استخدام برعم النمط الظاهري SHH زعنفة أيضا لتأكيد التفاعلات الجينية المحددة بين الجينات BBS. وتكشف هذه الدراسة شرط في الجسم الحي من أجل وظيفة BBS في برعم الطرف الزخرفة. نتائجنا توفر رؤى جديدة هامة في آلية والأهمية البيولوجية للBBS.

متلازمة بارديه-بيدل (BBS، OMIM 209900) هي جسمية اضطراب المتنحية غير المتجانسة وراثيا تتميز السمنة، وتنكس الشبكية، polydactyly بعد المحوري، الادراكي، نقص الأعضاء التناسلية، وتشوهات الكلى والقلب والأوعية الدموية وارتفاع نسبة مرض السكري وارتفاع ضغط الدم (1 - 3). حتى الآن، تم تحديد 12 جينات BBS (4 - +15). وعلى الرغم من بعد إلى توضيح وظيفة محددة من البروتينات الفردية BBS، والأدوار دعم البيانات في وظيفة الأهداب والنقل داخل الخلايا.
من اجل الحصول على نظرة ثاقبة الفيزيولوجيا المرضية لBBS، وضعنا BBS نماذج الزرد وأثبتت أن ضربة قاضية لأي من سبعة orthologs الزرد BBS (bbs2، 4، 5، 6، 7، 8 و 11) النتائج في الظواهر المماثلة. وتشمل هذه الظواهر تعطل حويصلة المهدبة يسمى الحويصلة كوبفر (KV)، الاستعداد لعيوب تجانب الجهاز وتأخر نقل إلى الوراء بين الخلايا (16). تحور BBS1 في البشر يؤدي إلى الشكل الأكثر شيوعا من BBS. وظيفة BBS1 غير معروف. يحتوي هذا البروتين مجال بيتا المروحة، مشيرا إلى أنه يتفاعل مع البروتينات الأخرى. نحن في الآونة الأخيرة أنه BBS1، بالتزامن مع BBS2، BBS4، BBS5، BBS7، BBS8 وBBS9، هو جزء من مجمع مستقرة متعددة البروتين المعروف باسم BBSome (17). BBS3، عاملا ADP-ribosylation (ARF) تشبه بروتين يعرف باسم ARL6 (18 تم التعرف)، عن طريق الاستنساخ الموضعية واستخدام علم الجينوم الحسابية (10). ويقترح البروتينات ARL أن يكون لها دور في حويصلة داخل الخلايا والاتجار الغشاء والتجمع أنيبيب (18، 19). باستخدام الزرد، ونحن اختبار ما إذا كان bbs1 وbbs3 الخسارة من وظيفة يلخص نموذجية BBS الظواهر ضربة قاضية بما في ذلك عيب KV وتأخير النقل داخل الخلايا. نحن أيضا تقييم التفاعل الوراثي الزوج الحكيم بين ثمانية جينات BBS الزرد (bbs1-bbs8). يسمح النظام النموذجي الزرد لفي وقت واحد الزوج الحكيم ضربة قاضية من مجموعات متعددة من الجينات BBS، بما في ذلك الجينات BBS هذا الرمز للبروتينات التي هي جزء من مجمع BBSome، وكذلك البروتينات التي ليست جزءا من المجمع. تركيبات الزوج الحكيم من أليغنوكليوتيد مكافحة الشعور تثبت ثمانية تفاعلات تعاونية هامة بين جينات معينة BBS. من المذكرة هو دور مركزي للbbs1 في خمس من هذه التفاعلات الوراثية. التفاعلات الوراثية في الجسم الحي المحددة في هذه الدراسة تكشف أن البروتينات BBS التي هي جزء من المجمع يمكن أن يؤدي إلى التفاعل الوراثي التآزر، والبروتينات يمكن أن ليست جزءا من مجمع BBSome.
polydactyly البشري هي واحدة من السمات الأساسية للBBS لا يرد في BBS نماذج الماوس خروج المغلوب (+20 - 23). وبالنظر إلى أن يتم التعبير عن العديد من الجينات BBS الزرد في مهدها زعنفة تطوير (16)، قمنا بتقييم زعنفة الزخرفة برعم في morphants BBS. ركزنا على منطقة النشاط الاستقطاب (ZPA) بسبب الدور الحاسم والحفظ تطويريا في الزخرفة في الطرف رباعي الأرجل / برعم الزعنفة. علينا أن نبرهن على ضربة قاضية الفردية الجينات BBS في الزرد، وكذلك الزوج الحكيم ضربة قاضية للجينات BBS، والنتائج في توسيع القنفذ الصوتي (SHH) التعبير، وهو مكون الجزيئي للZPA، وكذلك تغييرات على عناصر الهيكل العظمي لاحقة.


عرض الزرد bbs1 وbbs3 knockdowns BBS الظواهر نموذجية

في السابق، أثبتنا أن ضربة قاضية الفردية bbs2، bbs4 - bbs8 وbbs11 (9، 16) يولد الظواهر نموذجية في الزرد. من أجل تحديد ما إذا كان knockdowns من bbs1 وbbs3 تؤدي إلى الظواهر المماثلة، كنا morpholinos العقاقير لاسقاط هذه الجينات. وقد صممت oligonucleitides العقاقير morpholino (موس) لاستهداف bbs1 تقع على الصبغي 21 وbbs3 تقع على الصبغي 1 في الجينوم الزرد (معهد ويلكوم ترست سانجر، http://www.ensembl.org). المنظمات الأعضاء الموسومة فلوريسئين استهداف ميثيونين البادئ (أغسطس-MO) أو لصق موقع من exon2 تم microinjected (exon2-MO) في الأجنة. وقد وزعت على المنظمات الأعضاء بشكل موحد في 12-14 ساعة بعد الإخصاب (HPF) ولم الأجنة morphant لا تظهر أية تغييرات جسيمة في حجم الجسم العام ومورفولوجية مقارنة مع الضوابط. Bbs1 وقيمت morphants bbs3 المقبل لإجراء تعديلات نموذجية بما في ذلك الحد أو فقدان حويصلة مهدبة، والمعروفة باسم حويصلة كوبفر (KV)، الاستعداد لعيوب تجانب والتأخير في النقل جسيم ميلانيني الوراء (9، 16). الأسلاف KV تنشأ في خط الوسط الظهرية وتشكل حويصلة المهدبة في منطقة الذيل برعم خلال مراحل الجسيدة (+24 - +30). في البرية من نوع ومراقبة الأجنة المحقونة MO في مرحلة 10-13 الجسيدة، وKV على شكل دائرة يبلغ متوسط ​​حجم 50 ميكرون (الشكل 1 A و B). وقد لوحظت عيوب KV (خفض حجم ثلث أقل من المعتاد أو الكلي من غياب KV) بطريقة تعتمد على الجرعة في bbs1 MO وbbs3 حقن MO الأجنة (الشكل الجدول 1). وتمشيا مع وظيفة المقترحة للKV في اليسار واليمين التماثل محور (+24 - +30)، وأظهرت ضربة قاضية الزرد من bbs3 العيوب تجانب الجهاز تظهر الأجنة Bbs3 MO حقن التعديلات الركض هامة في 22-24 HPF (عكس أو لا هرول) و. حلقات العيوب في 36 HPF (31)، في حين أن جرعة منخفضة من bbs3 MO أو مراقبة الأجنة المحقونة MO لا تظهر KV كبير أو التعديلات تجانب (الشكل 1 E، الجدول 1).
الشكل 1.
bbs3 ضربة قاضية الظواهر في الزرد. (A - C) صور الأجنة الزرد حية في مرحلة 10-13 الجسيدة. (A) KV (مربع متقطع) هو حويصلة مهدبة تقع في منطقة الذيل برعم في البرية من نوع الجنين. (B) التكبير العالي للسيطرة KV (رأس السهم). (C) bbs3 حقن MO الجنين مع انخفاض KV (رأس السهم). التكبير: (A) 5 ×؛ (B و C) 10 ×. (D) نسبة العيوب KV الزرد (انخفاض أو غائبة) ولدت في MO ومجموعات التحكم. (E) نسبة العيوب تجانب القلب لوحظ في morphants bbs3 والضوابط. (F - H) التي يسببها ادرينالين جسيم ميلانيني النقل إلى الوراء، نظرا الأمامي الظهري من اليرقات البالغة من العمر 5 أيام. (F) من النوع البري اليرقات قبل العلاج ادرينالين و (G) عند نقطة 1.5 دقيقة بعد العلاج الادرينالين. (H) bbs3 morphant اليرقات يبدون استجابة تأخير بعد 3.0 دقيقة من العلاج الادرينالين. (I) التمثيل البياني للجسيم ميلانيني إلى الوراء مرة النقل التي يسببها الأدرينالين مما يدل على تأخير تعتمد على الجرعة في bbs3 ضربة قاضية بالمقارنة مع من النوع البري والأجنة حقن السيطرة. وأشارت العلاج وحجم العينة على X -axis وأشارت نسبة في الجزء العلوي من العارضة. * P <0.001.

الجدول 1.
وتشمل bbs1 وbbs3 ضربة قاضية الظواهر تعطيل تشكيل KV، عيوب تجانب القلب (الركض وحلقات) وتأخير كبير في جسيم ميلانيني النقل إلى الوراء

أثبتنا سابقا تورط ظيفة BBS في مجال النقل داخل الخلايا العام. وأسفرت - (bbs8 وbbs11 bbs2، bbs4) في تأخير ذات دلالة إحصائية في النقل إلى الوراء (ضربة قاضية للجينات BBS الزرد 16). مكوك الزرد الأجسام الصباغية داخل melanophores ردا على الإشارات البصرية والمحفزات الهرمونية (32 - 35). في الزرد تكييفها الظلام، وفرقوا الأجسام الصباغية (الشكل 1 F). جسيم ميلانيني التجميع (إلى الوراء النقل) يتم تحفيز على العلاج مع ادرينالين (الشكل 1 G) (16، 36). من النوع البري والأجنة حقن السيطرة تتراجع بسرعة الأجسام الصباغية (الشكل 1 الأول؛ الجدول 1). في المقابل، وجرعة عالية من bbs3 الأجنة المحقونة MO تأخر كثيرا جسيم ميلانيني التراجع (الشكل 1 H) (P <0.001)، في حين تظهر جرعة منخفضة من bbs3 الأجنة المحقونة MO معدل مماثل لأجنة التحكم (P> 0.05) ( الجدول 1). لوحظ نتائج مماثلة مع الأجنة المحقونة MO bbs1. وتشير البيانات المتوفرة لدينا أن الزرد bbs1 وbbs3 knockdowns تؤدي إلى الظواهر نموذجية مماثلة لغيرها من knockdowns BBS الجينات، بما في ذلك العيوب KV، الاستعداد لعيوب تجانب وإلى الوراء تأخير النقل داخل الخلايا.

التفاعل الجيني بين orthologs BBS الزرد

تحور أي من تحديد 12 جينات BBS الإنسان تسبب الظواهر المماثلة، بعد تحليل التنبؤ مجال البروتين تشير إلى أن البروتينات BBS لا تنتمي إلى أي فئة وظيفية واحدة (المواد التكميلية، الشكل S1). وقد اقترح أن التباين المظهري بين المرضى BBS ربما يعود إلى التفاعلات بين الجينات الوراثية BBS (37). لذا نحن اختبار الزوج الحكيم ضربة قاضية من bbs1-bbs8 في الزرد لتقييم التآزر بين هذه الجينات في الجسم الحي. حددنا أول جرعة subphenotypic لكل الثمانية BBS المنظمات الأعضاء. تم تحديد جرعة subphenotypic بوصفها أعلى جرعة MO الذي لا ينتج النمط الظاهري كبير عندما تم حقنها بشكل فردي في الأجنة الزرد (المشار إليها باسم '-'، الشكل 2 A؛ الجدول 2). نحن المقبل شارك حقن 28 مجموعات الزوج الحكيم المحتملة لجرعة subphenotypic-bbs1 bbs8 المنظمات الأعضاء. واعتبرت تفاعلات كبيرة (المشار إليها باسم '+'، الشكل 2 أ) إذا لوحظت في تغيير دلالة إحصائية في العيوب KV وزيادة جسيم ميلانيني النقل إلى الوراء بالمقارنة مع العلاج مع انخفاض جرعة واحدة MO. ثمانية من 28 حقن الزوج الحكيم الممكنة أدى إلى تفاعلات تعاونية. كل هذه التفاعلات المعنية إما bbs1 أو bbs2 كأحد مكونات التفاعل. حددنا خمسة bbs1 التفاعل المتآزرة (مع bbs2، bbs3، bbs4، bbs6 وbbs7 موس) وأربعة bbs2 التفاعل المتآزرة (مع bbs1، bbs3، bbs4 وbbs6 موس). Bbs3، bbs4 وbbs6 تفاعلت مع كل bbs1 وbbs2. تفاعلت Bbs7 فقط مع bbs1. أظهر Bbs5 وbbs8 لا التفاعلات الجينية مع أي الجينات BBS الآخرين. تركيبات التآزر ثمانية، وbbs1 مع مزيج bbs7 الزوج الحكيم أظهر الخلل KV أشد (الشكل 2 B) وتأخير النقل إلى الوراء (الشكل 2 C؛ الجدول 2). سبع مجموعات تعاونية أخرى، من أجل زيادة شدة،are bbs2 with bbs4 , bbs2 with bbs3 , bbs1 with bbs2 , bbs1 with bbs4 , bbs1 with bbs6 , bbs1 with bbs3 and bbs2 with bbs6 (Table 2 ). لتأكيد التفاعل المتآزرة، ونحن أجنة مع مجموعات الزوج الحكيم من جرعة عالية من bbs1 MO مع bbs7 MO شارك حقن. نحن أيضا تقييم جرعة عالية من مزيج من bbs3 MO مع bbs7 MO، وزوج غير متناغم. وجنبا إلى جنب جرعة عالية من bbs1 MO مع bbs7 MO إنشاء عيوب مثيرة، في حين أن جرعة عالية من الزوج الحكيم مزيج من bbs3 MO مع bbs7 MO أسفرت عن الظواهر مماثلة لتلك التي تم إنشاؤها بواسطة bbs3 MO جرعة عالية من حقن وحده، وbbs7 حقن جرعة عالية وحده (الشكل 3 أ و ب). توفر البيانات التآزر في أدلة الجسم الحي للتفاعل بين الجينات الوراثية المحددة BBS. هذه التفاعلات الوراثية يمكن أن تشير إلى التكرار وظيفية بين التفاعل الجينات و / أو رياضيات الكيمياء المطلوبة ضمن مجمع مهمة لوظيفة المناسبة من المجمع.
الرقم 2.
التفاعل الجيني بين ثمانية جينات BBS (bbs1 - bbs8). (A) ثمانية وعشرون تركيبات الزوج الحكيم subphenotypic من BBS MO أظهرت ثمانية فقط تفاعلات تعاونية، كما لاحظ علامة "+". التفاعلات الوراثية تؤدي إلى (B) اضطراب KV و (C) التي يسببها ادرينالين جسيم ميلانيني تأخير النقل إلى الوراء بالمقارنة مع الرقابة والأجنة جرعة منخفضة من BBS MO حقن. RNA محددة يمكن انقاذ تعطيل KV وجسيم ميلانيني تأخير النقل إلى الوراء. أضيفت مراقبة المنظمات الأعضاء عند الضرورة للحفاظ على التركيز النهائي موحد للMO في مزيج الحقن. * P <0.001؛ تابع والسيطرة.

الرقم 3.
جرعة متوسطة ضربة قاضية للوراثيا التفاعل BBS الجينات النتائج في زيادة شدة وانتفاذ من BBS الظواهر ضربة قاضية، بما في ذلك (A) اضطراب KV و (B) التي يسببها ادرينالين جسيم ميلانيني النقل إلى الوراء بالمقارنة مع من النوع البري، ضخت السيطرة والأجنة حقن مع مجموعات MO من BBS الجينات التي لا تتفاعل وراثيا. وأشارت العلاج وعدد الأجنة على المحور س والقيم على الجزء العلوي من القضبان. * P <0.001؛ تابع والسيطرة.

الجدول 2.
ملخص التفاعل الوراثي تقييمها من قبل BBS ضربة قاضية الجينات

خصوصية BBS ضربة قاضية

تم إجراء الانقاذ من الظواهر الناتجة MO-لتأكيد خصوصية ضربة قاضية الجينات. ركزنا هذا الجزء من الدراسة على bbs1 وbbs7 لسببين. أولا، لوحظ والجمع الأكثر أهمية التفاعل الجيني مع bbs1 وbbs7. ثانيا، تظهر bbs1 وbbs7 البروتينات تناظر كبير مع بعضها البعض. شارك في حقن في المختبر -transcribed bbs1 RNA مع جرعة عالية من bbs1 MO، وكذلك شارك في حقن bbs7 RNA مع جرعة عالية من bbs7 MO، النتائج في إنقاذ كل من KV والظواهر النقل إلى الوراء (الشكل 2 B و C ؛ الجدول 3). وهكذا، والإنقاذ RNA يدعم خصوصية bbs1 وbbs7 الظواهر التي يسببها MO. للتحقيق في ما إذا كان هو التفاعل بين الجينات الوراثية BBS يرجع إلى التكرار وظيفية، شاركنا في حقن جرعة عالية من bbs7 MO مع bbs1 RNA. لا يمكن انقاذ النمط الظاهري جرعة عالية من bbs7 يسببها MO مع bbs1 RNA. وبالمثل، جرعة عالية من bbs1 MO وجرعة عالية من الظواهر bbs3 MO لا يمكن انقاذ مع bbs7 RNA (الشكل 3 أ و ب). وتوفر هذه البيانات الإنقاذ RNA والجمع بين الزوج الحكيم في دليل فيفو للتفاعلات جينية محددة بين الجينات BBS وتشير إلى أن هذه التفاعلات الوراثية ليست بسبب التكرار وظيفية. في المقابل، إلى جرعة عالية من حقن MO التي تؤدي إلى الظواهر، وجرعة منخفضة من الحقن MO الفردية BBS المنظمات الأعضاء لا تولد الظواهر، ما لم يكن جنبا إلى جنب مع ثاني جرعة منخفضة محددة BBS MO. وعلاوة على ذلك، تم تقييم الإنقاذ RNA التفاعلات التآزر. وتم انقاذ الظواهر الناتجة عن الجمع بين حقن جرعة منخفضة من bbs1 MO مع bbs7 MO مع RNA bbs7 وحدها، وكذلك مع bbs1 RNA وحدها (الجدول 3). قدرة RNA bbs1 أو bbs7 RNA لانقاذ جرعة منخفضة جنبا إلى جنب ضربة قاضية إلى أن ضربة قاضية الجزئية إما bbs1 أو bbs7 وحده لا يؤدي إلى فقدان كامل للوظيفة مجمع BBSome.

الجدول 3.
BBS الجينات ضربة قاضية الإنقاذ واختبار وظيفة زائدة

الزخرفة تغيير في مهدها الزعنفة الصدرية الزرد

منذ polydactyly هي واحدة من السمات الأساسية للBBS البشري، وبحثنا إمكانية العيوب الزخرفة برعم الزعنفة في morphants BBS. في الواقع، يتم التعبير عن الجينات BBS على نطاق واسع، ولكن بنسبة 36 HPF bbs7 يظهر تخصيب الأمامي، مع التعبير ملحوظ في برعم الزعنفة النامية (16). في morphants BBS، كان حجم الزعانف عموما يمكن تمييزه من النوع البري، مما يشير إلى نمو زعانف عادية نسبيا وقدرتها على البقاء. وقد تطورت الزعانف الصدرية الزرد والأمامية رباعي الأرجل من أطرافهم الأجداد المشترك وتبادل التشكل مماثلة والآليات الجزيئية الكامنة مماثلة (+38 - 43)، بما في ذلك ZPA (44، 45) والتي يتم ترجمتها في اللحمة المتوسطة الخلفي من برعم الزعنفة / أطرافهم ( الشكل 4 A). ويشير ZPA المعلومات الموضعية هامة للمواصفات وأرقام. في الفرخ برعم الطرف، تطعيم لZPA الأمامي إضافي للZPA الأصلي أسفرت عن تشكيل ارقام اضافية تشبه polydactyly البشري (44). وأعرب عن القنفذ الصوتي (Shh على) في الخلفية الفقارية برعم الطرف اللحمة المتوسطة ويتوسط وظائف ZPA، بطريقة تعتمد على التركيز في كل براعم الزعنفة الزرد وبراعم الأطراف رباعي الأرجل (46). منذ زيادة ZPA وظيفة أو SHH النشاط قد يؤدي إلى polydactyly، قمنا بتقييم SHH التعبير. في البرية من نوع الأجنة، وأعرب عن الصورة صاحب السمو في مجال على شكل هلال في المنطقة الخلفية لبرعم الزعنفة الصدرية (الشكل 4 B). هذا مجال التعبير دون تغيير في السيطرة وجرعة منخفضة من الأجنة MO حقن (bbs1، bbs3 وbbs7). والزعنفة الصدرية SHH مجال التعبير في جرعة عالية من bbs1 أو bbs7 morphants يدل على التوسع الأمامي، في حين أن التعبير SHH في خط الوسط ظهري لم يتغير (الشكل 4 C). وتمشيا مع التفاعلات الوراثية التي سبق تحديدها، الزوج الحكيم مزيج من جرعة منخفضة من MO من bbs1 مع bbs7 أيضا أثبتت موسعة التعبير SHH (الشكل 4 D)، في حين أن الزوج الحكيم مزيج من جرعة منخفضة من MO من bbs3 مع bbs7 يظهر نفسه كما البرية من نوع (لا تظهر البيانات). تم قياس متوسط ​​مساحة التعبير SHH في مهدها الزعنفة الصدرية باستخدام برنامج يماغيج (47)، وأكد ذات دلالة إحصائية (P <0.001) يزيد في جرعة عالية من bbs1 MO، جرعة عالية من bbs7 MO وbbs1 مع bbs7 مزيج جرعة منخفضة في مقارنة مع البرية من نوع الأجنة (الشكل 4 E). وهكذا، في برعم الزعنفة النامية، نلاحظ زيادة نطاق ZPA / SHH دون تكدير أطرافهم / نمو زعانف العام.
الرقم 4.
منطقة النشاط الاستقطاب (ZPA) من برعم الزعنفة الصدرية والقنفذ الصوتي (SHH). (A) تمثيل تخطيطي من برعم الزعنفة الزرد قبل 48 HPF ZPA المترجمة الخلف، ويمكن أن يكون المسمى مع التعبير SHH. جبل بأكمله التهجين الموضعي باستخدام SHH باعتباره التحقيق في مهدها الزعنفة الصدرية من 42 HPF (B) من النوع البري، (C) morphant bbs7 و (D) جرعة منخفضة من bbs1 MO مع مزيج bbs7 MO. رأس السهم يدل SHH التعبير في برعم الطرف على جانب واحد، ويرد مجال التعبير على الجانب الآخر. (E) التمثيل البياني للمنطقة قياس (ميكرون 2) المجال التعبير SHH في مهدها الزعنفة الصدرية من morphants BBS والنوع البري. * P <0.001.

منذ طفرات وراثية لSHH تظهر خسارة أو الحد من عناصر الهيكل العظمي من الزعانف الصدرية (46)، ونحن مصممون المقبل ما إذا كان -signaling SHH توسعت في مهدها زعنفة من morphants BBS يدفع توسيع الصدرية الهياكل الزعانف. في الزعنفة الصدرية من اليرقات البالغة من العمر 6-7 يوما، العنصر الهيكل العظمي أكثر الداني هو cleithrum (الكلور)، الذي يمتد dorsoventrally (الشكل 5 A). المرافقة الكلورين هو كتفي غرابي (SC)، الذي يمتد على طول قاعدة الزعنفة، والعنصر الأكثر القاصي هي الزعنفة. تلطيخ الأزرق الألسيان في البرية من نوع يحدد مثل قضيب الكلورين (الشكل 5 B، السهم) والشوري المجاور (الشكل 5رأس السهم). BBS الأجنة morphant إثبات وجود الشوري الموسع (الشكل 5 C، رأس السهم)، حيث تظهر نهاية الخلفي البعيدة للالشوري لطبقات الخلايا غير منظمة و / أو إضافية مقارنة مع من النوع البري (الشكل 5 B). بما يتفق مع البيانات الجينية التفاعل، bbs1 مع bbs3 وbbs1 مع مجموعات جرعة bbs7 subphenotypic تظهر أيضا سميكة الشوري (الشكل 5 D، رأس السهم)، في حين bbs3 مع bbs7، التي لا يوجد لها تأثير متناغم على KV أو النقل إلى الوراء، يوضح هيكل برأسية مماثلة إلى البرية من نوع (لا تظهر البيانات). وهكذا، خطر ظيفة BBS التي كتبها النتائج حقن MO في توسيع التعبير SHH والزخرفة في وقت لاحق تغييرات في عناصر الهيكل العظمي للزعنفة الصدرية. وعلى الرغم من الزرد لا تشكل الأرقام، فإن هذه النتائج تشير إلى أن العيوب أطرافهم الزخرفة لوحظت في مرضى BBS ناتجة عن تشوهات SHH التعبير.
الرقم 5.
الصدرية الزرد زعنفة الغضروف تلطيخ. (A) التمثيل التخطيطي للهياكل زعنفة: الكلورين كخط ظهري بطني (السهم). الشوري البعيدة لالكلورين والأقرب إلى زعنفة. (B - D) الألسيان الأزرق تلطيخ الزعنفة الصدرية يوضح هيكل نموذج أولي للغضروف في العمر 6 ايام (B) من النوع البري اليرقات، في حين أن (C) يرقات bbs7 morphant و (D) جرعة منخفضة من الجمع بين bbs1 MO مع bbs7 MO تظهر بنية الشوري الموسع مع 2-3 خطوط الخلايا في المنطقة الخلفية القريبة من الشوري (رأس السهم).


وقد ثبت اثني عشر الجينات تسبب بشكل مستقل BBS في البشر. عرض المرضى BBS البشري ميزات مشابهة مستقلة عن تحور الجين الأساسي. لقد أظهرنا في وقت سابق ان ضربة قاضية الفردية من عدة جينات BBS الزرد (bbs2، bbs4-bbs8 وbbs11) النتائج في الظواهر الزرد المشتركة بما في ذلك تشكيل KV غير طبيعي، تشوهات أهداب وجسيم ميلانيني عيوب النقل (9، 16). في هذه الدراسة، علينا أن نظهر أن الخسارة من وظيفة الفردية bbs1 أو bbs3 في النتائج الزرد في نفس الظواهر كما ضربة قاضية أخرى الجينات BBS الزرد. بالإضافة إلى ذلك، فقد استخدمنا الآن في النظام النموذجي الزرد لتحديد التفاعلات بين الجينات الوراثية BBS عن طريق ضرب في وقت واحد أسفل تركيبات الزوج الحكيم من الجينات. لهذا التحليل في الجسم الحي من التفاعلات الوراثية، تم اختبار 28 مجموعات الزوج الحكيم الممكنة من الجينات BBS (bbs1-bbs8) في الجرعات التي لا تنتج النمط الظاهري عندما يتم استخدام morpholino الفردية (جرعة subphenotypic). في جرعات subphenotypic المستخدمة في هذه الدراسة، تم تحديد ثمانية الزوج الحكيم تفاعلات تعاونية. قبل هذه الدراسة، تم إنشاء أي نموذج حيواني لBBS polydactyly. باستخدام نظام نموذجي الزرد، حددنا الزخرفة غيرت من المهد الزعانف وتغييرات لاحقة لعناصر الهيكل العظمي الزعانف. منذ برعم الزعنفة الزرد هو orthologous لبرعم الطرف البشري، وتشير هذه الدراسة وجود صلة بين polydactyly بعد المحوري لوحظت في مرضى BBS وغيرت التعبير SHH في تطوير أطرافهم / برعم الزعنفة.
وظيفة BBS3 المطلوبة من أجل وظيفة الأهداب والنقل حويصلي داخل الخلايا

BBS3 (ARL6) هو ARF مثل البروتين (10). تدعم البيانات الأدوار الوظيفية المختلفة للبروتينات ARL، بما في ذلك تنظيم حويصلة داخل الخلايا والاتجار الغشاء والتجمع أنيبيب (18، 19). يوضح لنا فقدان البيانات من وظيفة أن النتائج bbs3 في نفس الظواهر الزرد كما knockdowns BBS الأخرى، بما في ذلك العيوب KV والخلايا تأخير النقل إلى الوراء. العثور على أهداب في KV يبدو أن تشكلت في البداية في bbs3 ضربة قاضية الزرد، ولكن يتم فقدان أهداب قبل الأوان، ولا تعمل في تشكيل KV العادي. وقد تم مؤخرا تبين أن سبعة البروتينات BBS (BBS1، 2، 4، 5، 7، 8 و 9) شكل مجمع المعروفة باسم BBSome (17). وBBSome يبدو أن تلعب دورا في تكون الأهداب، على الأقل جزئيا، من خلال التفاعل مع / الناتج المحلي الإجمالي عامل الصرف Rab8 GTP (Rabin8). Rab8GTP يدخل أهداب الابتدائي ويعزز تمديد الغشاء الهدبي. منع Rab8GTP إنتاج كتل ciliation وعوائد الظواهر BBS مميزة في الزرد (17). وإن لم يكن جزءا من BBSome، والبيانات المقدمة هنا مما يدل على أن bbs3 ضربة قاضية النتائج في عيوب في KV وأهداب العقدي، وكذلك في جسيم ميلانيني (يحلول عضيات ذات الصلة) النقل، ودعم دور للBBS3 والبروتينات BBS أخرى في مجال النقل الحويصلي ل وهدب (9، 16).

التفاعل بين الجينات الوراثية BBS

تظهر المرضى BBS الإنسان مجموعة واسعة من التباين المظهري. ويعتبر الاختلاف بين المرضى حتى ضمن العائلة الواحدة (وبالتالي مع نفس الطفرات BBS الأولية)، مشيرا إلى المعدلات الوراثية و / أو البيئة من النمط الظاهري. التباين المظهري والتباين الوراثي واسعة من BBS يرفع احتمال وجود تفاعلات معقدة بين الجينات BBS (37). في هذه الدراسة، حددنا ثمانية التفاعلات الوراثية من مجموع 28 التفاعلات الوراثية الزوج الحكيم الممكنة اختبارها. وتجدر الإشارة، كل واحد من ثمانية التفاعل المتآزرة أسفرت عن عيوب KV وتأخر نقل جسيم ميلانيني. لم يلاحظ أي تفاعلات تعاونية التي أثرت فقط مجموعة فرعية من الظواهر. في كل حالة، وزيادة الجرعة كل من morpholinos فوق جرعة subphenotypic أدى إلى زيادة شدة الظواهر ضربة قاضية BBS أبعد من ذلك لوحظ لالفردية ضربة قاضية جرعة عالية، ودعم الفرضية القائلة بأن الجينات BBS يمكن تعديل الظواهر بعضها البعض.
BBS التفاعلات المعقدة يمكن أن يعزى إلى أدوار زائدة عن الحاجة، وظيفة مسار مواز أو شرط stoichometric داخل مجمع البروتين مثل BBSome، على سبيل المثال عدد قليل من الاحتمالات. في هذه الدراسة، أثبتنا أن جرعة عالية من العيوب التي يسببها MO الفردية يمكن انقاذ من قبل المشارك حقن شكل من النوع البري من مرنا الجينات المحددة (أي bbs7 مرنا ينقذ جرعة عالية من bbs7 MO النمط الظاهري)، ولكن ليس عن طريق زيادة مستويات البروتينات BBS أخرى. على سبيل المثال، bbs1 مرنا لا إنقاذ جرعة عالية من العيوب التي يسببها MO-bbs7 والعكس بالعكس، يجادل ضد التكرار وظيفية. في المقابل، مرنا الفردية كافية لانقاذ subphenotypic المنظمات الأعضاء ضربة قاضية مجتمعة (أي bbs7 مرنا يمكن إنقاذ جرعة منخفضة من bbs7 جنبا إلى جنب مع bbs1 العيوب التي يسببها MO)، مما يشير إلى رياضيات الكيمياء المطلوبة داخل المجمع. دراسة حديثة أجرتها Nachury وآخرون. (17) وقد حددت BBS معقدة (وBBSome) وذكرت أن عناصر من مجمع موجودة بكميات متكافئة.
التعرف على مجمع BBSome تتألف من سبعة من 12 البروتينات المعروفة BBS (BBS1، BBS2، BBS4، BBS5، BBS7، BBS8 وBBS9) (17) يمكن استخدامها لتصنيف البروتينات BBS تعرف إلى تلك التي هي جزء من BBSome وتلك التي ليست جزءا من هذا المجمع (BBS3، BBS6، BBS10، BBS11 وBBS12). هذه المعلومات، جنبا إلى جنب مع البيانات التفاعل الوراثي من الدراسة الحالية، يسمح تحديد ما إذا كان BBS الزوج الحكيم التفاعلات الوراثية تنتج عن انخفاض قيمة اثنين من البروتينات BBSome، وضعف مكون من BBSome وعنصر عدم BBSome و / أو في وقت واحد انخفاض قيمة اثنين من البروتينات غير BBSome. وقد لوحظت أنواع الأولين من التفاعلات. على سبيل المثال، كان ينظر إلى أقوى التفاعل بين عنصرين BBSome (BBS1 وBBS7). بالإضافة إلى ذلك، اثنين من البروتينات غير BBSome التي درست (BBS3 وBBS6) عرضت كل من التفاعل وراثيا مع مكونات محددة من BBSome (BBS3 مع BBS1 وBBS2؛ BBS6 مع BBS1 وBBS2)، ولكن ليس مع مكونات BBSome الأخرى وليس مع بعضها البعض. وعلاوة على ذلك، والتفاعلات المادية المباشرة داخل المجمع BBSome لا يتوقع التفاعلات الوراثية. على سبيل المثال، BBS7 يتفاعل جسديا مباشرة مع BBS2 وليس مع BBS1 (17). ومع ذلك، BBS7 يتفاعل وراثيا مع BBS1، ولكن ليس مع BBS2.
على أساس من العثور على البديل متخالف في MGC1203 في عدد قليل من المرضى BBS، Badano وآخرون. (48) تستخدم الزرد لتقييم تأثير روكبي من mgc1203 على الجينات BBS وذكرت أن قمع متواضع من mgc1203 يمارس تأثير روكبي على النمط الظاهري التنموي للmorphants BBS. وبالمثل، knockdowns subphenotypic لدينا جينات معينة BBS الزرد إلى أن بعض الجينات BBS لها تأثير روكبي على النمط الظاهري من الجينات BBS أخرى. ومن الجدير بالذكر أن اثنين من الدراسات المستقلة استخدمت نهج subphenotypic مماثل في الزرد لتقييم التفاعلات الوراثية للbbs10 وbbs12 الجينات (12، 15). وتجدر الإشارة إلى أن واضعي ذكرت العيوب تكون المعيدة باعتباره النمط الظاهري BBS MO التي يسببها (12، 15، 48) وتستخدم هذه النمط الظاهري لتحديد التفاعلات المحتملة بين الجينات BBS. الأجنة morphant في دراستنا لا تظهر أية تغييرات جسيمة في حجم الجسم العام والتشكل. الظواهر عيب أهداب وتأخير النقل لوحظ في الدراسة الحالية هي ذات الصلة بيولوجيا إلى اضطراب البشري.
ذات أهمية سريرية، وتوفير البيانات لدينا نظرة ثاقبة وسائط غير المندلية من BBS الميراث. تم الإبلاغ عن الميراث Triallelic في مجموعة فرعية صغيرة من الحالات BBS (49 - 54). وتشير البيانات المتوفرة لدينا الزرد أن جرعة عالية من ضربة قاضية الفردية BBS الجينات النتائج في أهداب KV والظواهر النقل حويصلة (9، 16). هذه البيانات بيانات دعم الماوس خروج المغلوب أن خسارة كاملة للوظيفة البروتين BBS واحدة كافية للحث على الظواهر BBS (20 - +22). البيانات التفاعل الوراثية المقدمة هنا تشير إلى أن الأليلات hypomorphic وظيفيا من اثنين من البروتينات المحددة BBS يمكن أن تتضافر لتؤدي في الميراث digenic من BBS. على أساس البيانات الزرد يدل الظواهر ذات الصلة الناجمة عن ضربة قاضية في وقت واحد من اثنين من الجينات BBS، فمن المغري أن نفترض أن تغاير في اثنين من الجينات BBS (تغاير مزدوج) يمكن أن تكون كافية لإظهار بعض الظواهر BBS. لم يتم الإبلاغ عن حدوث ذلك. سوف توفر عدة نماذج الماوس BBS تسهيل اختبار هذه الفرضية.

ارتباط بين SSH والعيوب أطرافهم BBS

وقد تم ربط BBS الفيزيولوجيا المرضية لعيوب في وظيفة الأهداب والنقل داخل الخلايا. ومع ذلك، فإن لم يبلغ عنها polydactyly باستمرار في الأمراض الهدبية (+55 - 58). لذلك، وصلات الآلية بين وظيفة الأهداب وpolydactyly لا تزال غير واضحة. منذ الزرد الاقتران الزعانف والأطراف رباعي الأرجل ترتبط phylogenetically، شكليا مماثلة (42، 43، 59) وعرض مماثلة أنماط التعبير الجيني في تطوير أطرافهم / براعم الزعانف، يمكننا استخدام هذا النظام لتحليل الآليات الجزيئية التي تكمن وراء تطورها المبكرة (+38 - 43). BBS الخسارة من وظيفة يدل على توسيع SHH التعبير في مهدها الزعنفة الصدرية دون أن يؤثر ذلك SHH العصبي أنبوب التعبير. وعلاوة على ذلك، هناك حاجة SHH للتنمية داخل الهيكل زعنفة / أطرافه (43)، وأظهر متحولة الزرد SHH (سيو) فقدان الصدرية حزام عناصر الهيكل العظمي (46، 60)، في حين أن التعبير خارج الرحم من Shh على الدجاج في الثقافة برعم الطرف MICROMASS يسببها الغضاريف رواية عقيدات (61). تحليل للعناصر الهيكلية في BBS اليرقات ضربة قاضية كشف كتفي غرابي سميكة من الزعنفة الصدرية بما يتفق مع زيادة التعبير SHH في مهدها الزعنفة الصدرية. على الرغم من أن تم الإبلاغ عن وظيفة الأهداب وIFT للعب دور في SHH الإشارات (56، 62، 63)، وتستخدم الدراسة الحالية لدينا SHH كعلامات لZPA. بالإضافة إلى ذلك، SHH التعبير في خط الوسط هو رابط الجأش. هناك حاجة إلى مزيد من الدراسة لمعالجة مباشرة لدور أهداب أو نقل الخلايا في تنظيم SHH في morhpants BBS.ومع ذلك، توفر البيانات المتوفرة لدينا في الجسم الحي دليلا على وجود دور وظيفة BBS في أطرافهم / زعنفة برعم الزخرفة مما أدى إلى زيادة SHH الإشارات.

المواد والأساليب

MO العقاقير

وقد صممت المنظمات الأعضاء العقاقير والتي تم شراؤها من أدوات الجينات، LLC. تم microinjected المنظمات الأعضاء في ما يقرب من 3 مجلدات نانولتر في 07:59 الأجنة الخلية بتركيزات تتراوح بين 125-500 م م. تسلسل MO الزرد هي bbs1 _aug (GGGAACAGATGACATGGTTGTTTTG)؛ bbs1 _ exon2 (TGAAACTCACCAATGCATGAGGAGA)؛ السيطرة MO bbs1 _5mis (TAAGaGTGAtGATGGcCACTtGCAT)؛ bbs3 _aug (AGCTTGTCAAAAAGCCCCA TTTGCT)؛ bbs3 _exon2 (TACATCTTTTATTTTCACCTTGAGG) والسيطرة MO bbs3 _5mis (AGgTTcTCAAAAAaCCCgATTTcCT).

الزوج الحكيم مزيج من BBS morpholinos

اثنين من المنظمات الأعضاء BBS مختلفة تستهدف bbs1-bbs8 كانت مجتمعة في الجرعات المنخفضة subphenotypic (125 μ M لكل منهما) وmicroinjected في 07:59 الأجنة الخلية. وكانت الضوابط لهذه التجارب مجموعات من جرعة منخفضة من كل BBS MO والتحكم MO (125 μ M لكل منهما). التركيز النهائي من المنظمات الأعضاء حقنه في أي الجنين في هذه التجربة كانت دائما ثابتة (250 μ م).

تحليل KV

والحويصلات في الأجنة التي يبلغ قطرها أقل من ثلث أن من النوع البري يعتبر انخفاض وتم سجل الأجنة التي الحويصلات لا يمكن تحديد شكليا كما تغيب. تم تصوير الأجنة الحية مع زايس Axiocam على المجسام.

فحص النقل جسيم ميلانيني

تعرض يوم 5 اليرقات إلى ادرينالين (50 ملغ / مل، سيجما، E4375) تضاف إلى الجنين المتوسطة (64) لتركيز النهائي من 500 ميكروغرام / مل. تم رصد جسيم ميلانيني تراجع باستمرار تحت المجهر وسجل نقطة النهاية عندما كانت جميع الأجسام الصباغية في الرأس والجذع محيط بالنواة.

إنقاذ النمط الظاهري ضربة قاضية

وsubcloned مقاومة للMorpholino BBS RNA إلى pCS2 + ناقلات التعبير (65). وقدم RNA الاصطناعية مع mMessage mMachine (AMBION). مرنا (50 نانوغرام / ميكرولتر bbs1 و 100 نانوغرام / ميكرولتر bbs7 كان) شارك في حقن MO المناسب.

جبل بأكمله، في الموقع التهجين من SHH في براعم الزعانف الصدرية

الأجنة، وتعامل مع الصباغ المانع في 12 HPF، كان المثقف إلى 42 HPF وثابتة مع بارافورمالدهيد 4٪ / الفوسفات مخزنة المالحة (PBS). SHH تم توليفها تحقيقات RNA (روش) من القوالب خطي، العقاقير (digoxigenin-UTP جمعية مهندسي البترول I ، T7 RNA البلمرة) والمعنى (ليس أنا، البلمرة SP6 RNA). جبل بأكمله، في الموقع التهجين أنجز كما وصفها الين وآخرون. (16). مجال SHH تم قياس التعبير عن الرأي 1.37v يماغيج (47). الطالب ر استخدمت -test افتراض عدم المساواة التباين لتقييم فروق ذات دلالة إحصائية في متوسط ​​مساحة SHH التعبير (P <0.001). تم تصوير الأجنة في 50 × التكبير.

الغضروف تلطيخ

تم إجراء الغضروف تلطيخ كما هو موضح في تايلور وفان دايك (66). لفترة وجيزة، اليرقات في 6 أيام بعد الإخصاب (إدارة الشرطة الاتحادية) كانت ثابتة بين عشية وضحاها مع بارافورمالدهيد 4٪ / برنامج تلفزيوني، المجففة تدريجيا مع الايثانول المطلق وملطخة بين عشية وضحاها مع الألسيان الأزرق (30 ملغ في 8: 2 الايثانول: حامض الخليك الجليدي). واليرقات ثم ابيض مع 1٪ هيدروكسيد البوتاسيوم (1 M) / 3٪ بيروكسيد الهيدروجين، مسح مع 0.5٪ trypsine / المشبعة tetraborate الصوديوم، ودرجة الحموضة 9.1، لمدة 2 ساعة والمخزنة في 7: 3 الجلسرين: (1X) PBS. تم تصويرها يتصاعد الغضروف في 50 × التكبير.

رافت ابراهيم 11-23-2015 08:23 PM

استكشاف الأساس الجزيئي لمتلازمة بارديه-بيدل

قليل راثي اضطرابات المتنحية عرض درجة تعدد النمط الظاهري وعدم التجانس الوراثي الموجود في متلازمة بارديه-بيدل (BBS)، وهو اضطراب وراثي يتميز أساسا عن طريق ضمور شبكية العين، والسمنة، polydactyly وضعف الإدراك والغدد التناسلية وخلل تكون الكلوي. تم الإبلاغ عن هذه حالة نادرة نسبيا في كثير من الأحيان، ولكن بدأنا مؤخرا فقط لتقدير تعقيدات الوراثية التي تؤدي إلى هذه الكوكبة من النتائج السريرية. خلال ال 12 شهرا الماضية، وقد تم تحديد أول ثلاثة لا تقل عن ستة جينات BBS، يقدم لنا لأول مرة مع القدرة على صياغة فرضيات فيما يتعلق بأسباب الجزيئي للاضطراب. نحن هنا استعراض العناصر الرئيسية لالنمط الظاهري ومناقشة أهمية اكتشاف أول ثلاثة جينات BBS على الجهود المبذولة لتحديد أسباب الخلوية من هذه المتلازمة.
القسم السابق القسم التالي
تلقى 19 يوليو 2001. قبلت 30 يوليو 2001.

القسم السابق القسم التالي
متلازمة بارديه-بيدل (BBS، MIM 209900) هي جسمية متعددة نظام اضطراب المتنحية، والتي تتميز الضمور قضيب مخروط والأطراف التصنع، والسمنة المركزية، قصور الغدد التناسلية، وصعوبات التعلم والنمو الشاذ الكلوي. ميزات أخرى من فترات زمنية متفاوتة وتشمل، من بين أمور أخرى، داء السكري، تليف كبدي، تشوهات الإنجابية، وأوجه القصور الغدية، قصر القامة، والتخلف التنموي والكلام والانحرافات السلوكية. BBS يحدث في جميع أنحاء العالم مع ترددات مختلفة. معدلات انتشار المرض في أمريكا الشمالية وأوروبا تتراوح بين 1: 000 140-1: 160 000 livebirths (1 - +3). ومع ذلك، في الكويت ونيو فاوند لاند سعر أعلى من ذلك بكثير، مع حدوث قدر من 1:13 500 و01:17 500، على التوالي، بافتراض تأثير مؤسس (4، 5).

موجز السريري للBBS

تصنيف المظاهر السريرية للBBS معقد وغامض بسبب التباين المظهري وضوحا من هذا الاضطراب. من استعراض تقارير حالة وتجربتنا يبدو أن هناك ما يصل الاختلاف داخل الأسرة interfamilial كما، مع عدم وجود دليل على أي تحيز سباق محددة أو أدلة حول راثى الكامنة (1، 6). بناء على انتشار نسبي، ويمكن تقسيم النمط الظاهري السريرية إلى الميزات الرئيسية والثانوية (الجدول 1).

الجدول 1.
المعايير التشخيصية لمتلازمة بارديه-بيدل (12)

تنكس الشبكية

ضمور الشبكية هي واحدة من السمات المميزة لهذا الاضطراب، وجدت في بعض الأحيان في العقد الأول ولكن الحاضر في جميع المرضى تقريبا في العقد الثاني (7). ظهور قاع لا يتوقع رؤية وصفت الخلل باعتباره ضمور الشبكية الصباغي شاذة من خلايا مستقبلة للضوء بمشاركة البقعي في وقت مبكر (الشكل 1 A) (8 - +11).
الشكل 1. (A) مظهر الشبكية على تنظير القاع من ذكر BBS البالغ من العمر 32 عاما يعانون من مرض السكري. لاحظ التجميع الطرفية تصبغ أسود ووجود المبكر تحت المحفظة إعتام عدسة العين. (B) الجانب الشخصي من الذكور البالغين مع BBS تبين مكانة وتوزيع الأطراف الوسطى والعليا من الأنسجة الدهنية نموذجية من هذا الشرط. (C) polydactyly نموذجي الأيدي، و(D) القدمين. هذا هو دائما تقريبا بعد محوري في BBS. (E) مستعرض البطن فحص CT القسم يدل على الكلى multicystic من BBS صبي يبلغ من العمر 12 عاما الذي كان وظيفة الكلى طبيعية.


السمنة هي السمة الرئيسية الثانية من BBS (الشكل 1 B)، مع تردد من 72-96٪ حسب معايير القياس (3، 12). السمنة عادة ما يبدأ في مرحلة الطفولة وشدة يزيد مع التقدم في السن، مع الغالبية العظمى من الحالات ظهرت عليهم اعراض خلال السنة الأولى من العمر. توزيع الأنسجة الدهنية على نطاق واسع في مرحلة الطفولة ولكنه يصبح الأبرز في الجذع والأطراف القريبة في مرحلة البلوغ. على الرغم من أن السبب غير معروف، وقد افترض تشوهات لكل من الغدة النخامية وتحت المهاد (13، 14).

تشوهات الأطراف

الميزة الرئيسية الثالثة التي هي عادة ولكن ليس دائما، وجدت في BBS هي polydactyly بعد المحوري (الشكل 1 C و D). بالإضافة إلى polydactyly، تم الإبلاغ عن تشوهات الأطراف الأخرى على ترددات مختلفة (12). من هذه، قصر الأصابع (الأصابع القصيرة) من كلتا اليدين والقدمين هو الأكثر شيوعا، ويرتبط أحيانا مع ارتفاق الأصابع الجزئي (عادة ما بين أصابع القدم الثانية والثالثة وغاب في الآباء)، الإصبع الخامس انحراف الأصابع (إصبع incurved) وجود فجوة بارزة بين أصابع القدم الأولى والثانية (ما يسمى "صندل الفجوة ').


التخلف العقلي هو سمة من سمات أكثر المتنازع عليها BBS. على الرغم من أن الدراسات المبكرة وصف انخفضت IQ كسمة رئيسية من BBS، وكان في كثير من الأحيان لم تؤخذ حدة البصر بعين الاعتبار. في دراسة استعادية بيل (13)، وقال 86٪ من المرضى الذين لديهم خلل عقلي. تم التحقق من هذه النتيجة كلاين وآمان (3)، الذي أفاد نسبة عالية (78٪) مع التخلف العقلي، وحاول أيضا لتصنيف شدتها إلى خفيفة، معتدلة وحادة. وخلصوا إلى أن معظم الحالات (~55٪) أظهرت فقط 'معتدل ضعيف الأفق. ومنذ ذلك الحين، قررت اختبارات الذكاء موضوعية أكثر الاخيرة أن أقلية فقط من المرضى مصابون بتخلف عقلي (5).

نقص الأعضاء التناسلية وتشوهات الأعضاء التناسلية

يقال نقص الأعضاء التناسلية بشكل متكرر أكثر في الذكور أكثر من الإناث BBS (3، 13). أعطت العديد من النساء المتضررات الولادة وحتى الأطفال، ولكن لم يكن هناك سوى تقريرين من الذكور المتضررة إنجاب الأطفال (3، 12، 13، 15). السبب هو توفر تقارير الحالة غير معروفة والعديد من الأدلة على فشل الأساسي الغدد التناسلية (5، 16)، فشل محور الغدة النخامية (17) أو كليهما (18).
في الإناث BBS، تشوهات الأعضاء التناسلية تشمل مجموعة واسعة بما في ذلك نقص التنسج فالوب أنابيب والرحم والمبايض، رتق المهبل الجزئي والكامل، فتحة المهبل تغيب وتغيب مجرى البول فتحة (3، +19 - 23). وقد تشخص خطأ بعض الحالات من BBS باسم متلازمة McKusick-كوفمان (MKKS؛ متلازمة تتميز موه رحمي مهبلي، polydactyly وأمراض القلب الخلقية) على هذا الأساس (24).

الفشل الكلوي

وقد تم مؤخرا فقط الاعتراف الفشل الكلوي ليكون عنصرا من عناصر النمط الظاهري السريرية BBS. قبل 1980s، وكان قد تم الإبلاغ عن تشوهات الكلى في BBS النادر (+25 - +27)، على الرغم من أن وتيرة عالية من تشوهات هيكلية لوحظت بعد الوفاة (الشكل 1 E) (19، 21). وقد أشارت الدراسات الحديثة أن النمو الشاذ الكلوي يمكن أن تكون موجودة من دون أدلة سريرية من مرض الكلى، وهذا ما يفسر underdetection من هذه الميزات (28، 29). في دراسة واحدة، وكان 26/57 المرضى (46٪) تشوهات هيكلية الكلى. ومع ذلك، كان 5٪ فقط اضطراب وظيفي في وقت التقييم (12).

المظاهر السريرية طفيفة

بالإضافة إلى ميزات التشخيص الرئيسية للBBS، كما تم توثيق ملامح طفيفة متعددة في المرضى على ترددات مختلفة. وتشمل هذه التنموي تأخير والكلام وعجز اللغة، والذهان، خلل البنية؛ شوهة الوجه، والاختلافات في الارتفاع، تشوهات العصبية، فقدان السمع، التمثيل الغذائي واضطرابات الغدد الصماء بما في ذلك مرض السكري، كلوي مرض السكري الكاذب، وتشوهات القلب والأوعية الدموية، اضطرابات الأسنان وظيفة الكبد، ورتق العاني و مرض Hirschprung (انظر 12 للحصول على وصف أكثر شمولا).

جينات BBS

نمط الميراث العائلي من النمط الظاهري يوحي بأن BBS هو واحد الجينات جسمية اضطراب المتنحية. وهذا يشكل تحديا لشرح كيفية تعطيل وظيفة بروتين واحد يمكن أن يؤدي إلى مثل هذا النمط الظاهري المتنوعة التي تشمل كلا التنموي (على سبيل المثال polydactyly) والتقدمية (مثل ضمور شبكية العين) وجود عيوب.
التحليلات الجينية الأولية من تعقيد النموذج BBS. اتساق نسبي من النمط الظاهري أدى إلى توقع أن النمط الظاهري BBS سوف خريطة لمكان واحد. ومع ذلك، كشفت دراسات الربط التباين الجيني الكبير: تم التعرف على ستة BBS مواضع حتى الآن، مع دليل واحد على الأقل مكان إضافي في الجينوم البشري (الجدول 2). تم تعيين BBS موضع الأول (BBS2) في عام 1993 بعد الفحص الجينوم على نطاق باستخدام نسب الإسرائيلي الأقارب كبير أظهر الربط D16S408 على 16q21 (30). بعد فترة وجيزة، تم الإبلاغ عن موضعا الثاني (BBS1) بعد تفتيش على نطاق الجينوم باستخدام 31 عائلة الأباعد أمريكا الشمالية أثبتت أن BBS1 وPYGM على 11q13 كانت مرتبطة وكان ذلك BBS1 موضع رئيسي BBS، حيث تمثل ~40٪ من جميع الأنساب (31). تم تحديد مواضع الثالث والرابع (BBS3 وBBS4) على 3p12-13 و15q23، على التوالي، وذلك باستخدام نهج زيجوت متماثلة الألائل عينة مجمعة في اثنين من العائلات البدوية الأقارب كبيرة (32، 33). تم تعيين موضع الخامس (BBS5) ل2q31 استخدام الخرائط جود زيجوت متماثلة الألائل في واحد، نيوفاوندلاند كبير المشابهة (34)، في حين تم تعيين BBS موضع تحديدها مؤخرا (BBS6) ل20p12 (35)، وذلك باستخدام لفيف من الأسر نيوفاوندلاند BBS أن استبعدت من BBS مواضع معروفة (36). وأخيرا، تم توثيق وجود السابع وحتى الآن لم تكتشف، موضع باستبعاد راثيا عدة سلالات من جميع مواضع معروفة (37).

الجدول 2.
ملخص لموقف الجيني للجميع مواضع BBS والطريقة المستخدمة لتحديد وضعهم

المرضية الجزيئية للBBS

بعد عدة سنوات من الجهود الاستنساخ الموضعية المكثفة، تم تحديد أول ثلاثة جينات BBS على مدى الأشهر ال 12 الماضية. في حالة عدم وجود أدلة فسيولوجية أو كيميائية حيوية، قدمت هوية هذه الجينات الأدوات الوحيدة لاكتساب نظرة ثاقبة الأساس الجزيئي للاضطراب.
استنساخ الجين لMKKS على 20p12 (38) تسهيل التعرف على أول BBS الجين (BBS6). MKKS لديه بعض التداخل المظهري مع BBS مثل polydactyly وموه رحمي مهبلي. الأهم من ذلك، وقد ذكرت عدة MKKS المرضى الذين تطورت لاحقا ضمور شبكية العين والسمنة وبالتالي تم تصنيفها إعادة كما BBS (24، 39). هذه الملاحظة، إلى جانب ترسيم فترة حرجة BBS6 إلى منطقة ميغابايت 1.9 والتي تضمنت MKKS (35) أثبتت الحرجة، كما عرضت الطفرات في MKKS من قبل اثنين من المجموعات المستقلة أن يسبب BBS (35، 40).
وقد تم تحديد كل من BBS2 وBBS4 باستخدام الطرق التقليدية الموضعية الاستنساخ، حيث استخدمت recombinants الأجداد لتحسين فترات حرجة إلى المنطقة 2 سم على 16q21 ومنطقة سم 1 على 15q22.3-Q23. أدى تحليل تسلسل الجيني لتحديد عدة جينات مرشحة في كل منطقة، واحدة من التي كانت تظهر في نهاية المطاف الى الميناء الطفرات المسببة للأمراض في كل حالة (41، 42).

البروتينات BBS

وتشير النوكليوتيدات والبروتين تناظر عمليات البحث التي BBS6 / MKKS يشبه archeobacterial chaperonins وبروتينات حقيقية النواة ذات الصلة مجمع-T (برنامج التعاون الفني). وقد أشارت النمذجة ثلاثية الأبعاد أيضا أن البروتين الذي أضعاف أفضل يشبه MKKS هو thermosome archeal من Thermoplasma acidophilum (38). thermosomes Archeal وأفراد من عائلة TCP تنتمي إلى فئة النوع الثاني من chaperonins. وعلى النقيض من النوع الأول chaperonins، والتي غالبا ما ترتبط مع ظروف الإجهاد الخلوي (مثل البروتينات الحرارة صدمة)، هو متورط فئة النوع الثاني في تسهيل البروتين الوليد قابلة للطي بطريقة تعتمد على ATP (لاطلع 43 - 45).
على عكس BBS6، وتسلسل الأحماض الأمينية من BBS2 لا يقدم رؤى وظيفية. بخلاف الحفظ قويا في الكائنات الحية ويعني التسامح يقتصر على الاختلاف، وتسلسل الرئيسي للBBS2 لا تتحمل التماثل إلى أي بروتين يعرف، كما أنه لا يحتوي على أي زخارف التعرف عليها (42). النمذجة الحاسوبية من التكوين ثلاثي الأبعاد من BBS2 لا يتوقع وجود مجال ملفوف لفائف بالقرب من N-محطة من البروتين (بيانات غير منشورة). قد يشير هذا إلى أن BBS2 يبلمر مع نفسها أو غيرها من البروتينات (لمراجعة مؤخرا ملفوف لفائف المجالات ترى 46). وظيفة متنوعة في هذا المجال، ومع ذلك، لا توفر أدلة وظيفية أخرى. تم العثور على-لفائف ملفوف في طائفة واسعة من البروتينات، بدءا من البروتينات هيكل الخلية مثل α الكيراتين (47) والبروتينات المحركات الجزيئية مثل الميوسين (48)، لمفاتيح تعتمد على درجة الحموضة مثل مستقبلات بلعم زبال (49) وعوامل النسخ مثل السوستة GCN4 يسين (50). سوف تكون هناك حاجة للمزيد من التجارب لتحديد دور الفسيولوجية للBBS2 في الخلية.
البروتين BBS حددت مؤخرا، BBS4، ينتمي إلى فئة وظيفية بعد آخر من البروتينات، حيث يظهر تشابه كبير إلى ربط O N -acetylglucosamine (O-GlcNAc) ترانسفيراز (OGT) من عدة أنواع (41). O-GlcNAc بتعديل عدد كبير من البروتينات نووي هيولي ويعتقد أن تلعب دورا هاما في الإشارة عن طريق تحديد كيفية استجابة الخلايا للمحفزات خارج الخلية (51). بالإضافة إلى ذلك، BBS4 يحتوي على المحتملين tetratricopeptide تكرار عزر (TPR) (41). ويعتقد أن هذه الهياكل للتوسط تفاعلات البروتين البروتين في مجموعة متنوعة من العمليات الخلوية (52). ولذلك فمن الممكن أن الاحواض BBS4 مع بروتينات أخرى لglycosylate بقايا محددة من أجل إما نشر أو إشارة كتلة تنبيغ.

BBS الطفرات والنمط الظاهري

دراسة أنواع ومواقف جميع الطفرات وجدت في أول ثلاثة جينات BBS يوفر نقطة دخول حاسمة لفهم طبيعة الجزيئية للأمراض. العديد من BBS2، BBS4 وBBS6 الطفرات إما frameshifts، مغلطة أو لصق الانحرافات (الجدول 3). على سبيل المثال، تم الإبلاغ عن المرضى الذين يعانون من انزياح الإطار متخالف طفرات متماثل أو مجمع BBS (35، 40 - +42)؛ هذه الكودونات إدخال إنهاء المبكرة وإما تنتج البروتين اقتطاع بشدة أو، على الأرجح، يؤدي إلى تسوس RNA بوساطة هراء (53). الطفرات نقطة هراء وجدت في جميع الجينات BBS ثلاثة قد يكون له تأثير مماثل (37، 41، 42 وبيانات غير منشورة). هذا يشير إلى أن من المحتمل أن يكون نتيجة لفقدان وظيفة أي من البروتينات BBS ثلاثة BBS. ما إذا كان يتم إبطال مواضع تماما أو ما إذا ظل هناك نشاط البروتين القاعدي لا يزال يتعين تحديدها.

الجدول 3.
ملخص لجميع الطفرات ذكرت لجينات BBS الثلاثة، وعندما معروف، فإن التأثير المتوقع على البروتين

ومن غير الواضح أيضا ما إذا كان هناك أي ارتباط بين طبيعة الطفرات BBS وشدة المرض. قد يتوقع المرء أن الطفرات مغلطة من شأنه أن يؤدي في النمط الظاهري أكثر اعتدالا. قد يكون هذا هو الحال بالنسبة لبعض الطفرات BBS2. على سبيل المثال، فقد قيل أن V75G تغيير متماثل قد يؤدي إلى النمط الظاهري "أصغر حجما"، بالمقارنة مع انزياح الإطار ولصق الطفرات تقاطع (42)، على الرغم من الحاجة إلى مزيد من العائلات لإثبات هذه الملاحظة.
ويمكن إجراء جود ارتباط أقوى النمط الظاهري النمط الجيني لبعض الطفرات BBS6، ولكن حتى ذلك الحين التفسير قد لا يكون بهذه البساطة كما اقترح في البداية. اقترحت غالبية الطفرات التي أعلن عنها في الدراسات BBS6 الأولى أن مجموع الخسائر من وظيفة يسبب BBS (35، 40)، في حين الأليلات أكثر اعتدالا تؤدي إلى MKKS (38). وأدى ذلك إلى فرضية أن MKKS هو البديل hypomorphic من BBS (35). ومع ذلك، فإن الطبقات الجزيئي بين متلازمات اثنين من المرجح أن يكون أكثر تعقيدا. أولا، كانت جميع ولكن واحدة من الطفرات التي أعلن عنها في دراسة لاحقة باستخدام الفوج المريض الأباعد كبيرة التعديلات مغلطة (37). ثانيا، أليلين متحولة المرتبطة MKKS، Y37C وA242S، تم العثور أيضا في المرضى الذين يعانون BBS (35، 37)، مما يشير إلى أنه قد يكون من الجمع بين كل من الأليلات التي تحدد شدة النمط الظاهري. حتى هذه الفرضية، ومع ذلك، قد يثبت أن التبسيط. وتشير البيانات الجينية وطفرية أن بعض حالات BBS قد تكون ناجمة عن طفرات في مكان واحد أو أكثر، كما تم الكشف عن العديد من الطفرات BBS6 في الأنساب استبعاد وراثيا من BBS6 على أساس تحليل النمط الفرداني. في حالة واحدة على الأقل، ونسب لتعيين BBS2 (الاستدلال النمط الفرداني 37). إذا تم إثبات هذه الملاحظة من خلال بيانات طفرة وراثية، وطبيعة hypomorphic من MKKS قد يكون نتيجة لكل من عدد الأليلات الطافرة الموروثة وطبيعة اندماجي من الطفرات.


التحليلات طفرية جميع BBS مواضع معروفة ثلاثة تثير قضية أخرى تتعلق الصفات الوراثية للمرض في نيو فاوند لاند، حيث واجه BBS (في كثير من الأحيان 4). وقد استعمرت جزيرة نيوفاوندلاند في 1700s من قبل عدد قليل من العائلات البريطانية والايرلندية الذي أسس المجتمعات المعزولة الصغيرة على طول الساحل. ويعتقد أن محدودية الجينات الأولي وندرة الهجرة بسبب العزلة الجغرافية لحساب معدل مرتفع من الاضطرابات المتنحية بحكم تأثير مؤسس (54). وقد تبين أن مثل هذه الطفرات مؤسس موجودة في نيوفاوندلاند لعدة اضطرابات مثل العديد من الأورام الغدد الصماء (55)، البوليبات غدومي عائلي (56) وغير polyposis سرطان القولون والمستقيم وراثي (57). وعلى الرغم من توقع أن وتيرة عالية من BBS في الجزيرة كان أيضا بسبب طفرة مؤسس، وقد تجلى موضع عدم التجانس على حد سواء وراثيا وذلك من خلال بيانات طفرة وراثية. تم العثور على اثنين من النسخ المتنوعة المرتبطة المرض في نيوفاوندلاند لBBS1 (58 وبيانات غير منشورة). وقد تم تعيين اثنين من العائلات وراثيا لBBS2 (36)؛ وقد تم ربط عائلة أخرى إلى BBS3 (59)، في حين بعد آخر أسرة BBS5 محددة (34). كما تم العثور على ثلاث طفرات BBS6 متميزة في الأنساب نيوفاوندلاند (35، 40). وأخيرا، ويشتبه في الميراث digenic أيضا في واحدة نيوفاوندلاند النسب (37).
هذا المشهد الوراثي تذكر آخر ضمور العضلات المتنحية، واضطراب غير المتجانسة وراثيا، والأطراف الاصطناعية الزنار (LGMD). ويبلغ عدد سكان الجزيرة الواقعة في المحيط الهندي لا ريونيون، يسلك ارتفاع وتيرة LGMD3. وعلى الرغم من التنبؤ بأن ذلك يرجع إلى تأثير مؤسس، تم العثور على العديد من النسخ المتنوعة المرتبطة المرض والطفرات في Calpain 3. سمي هذا "لا ريونيون مفارقة" وافترض الميراث multigenic كما تفسير واحد (60). و"نيوفاوندلاند مفارقة 'هو أكثر وضوحا في ذلك ليس فقط هناك طفرات متعددة في نفس الجينات وجدت في نيوفاوندلاند (يتضح من الطفرات الثلاث المختلفة في BBS6)، ولكن أيضا مواضع متعددة. عن وجود ثمانية الطفرات مؤسس منفصلة غير المحتمل، فإنه من الصعب التوفيق بين هذه البيانات مع وتيرة مرتفعة من المرض. ولعل مفتاح حل هذا اللغز سيكون للنظر في الميراث multigenic، حيث يكون واحدا طفرة مؤسس السلفية تتصرف كما القابلية موضع المهيمن قد يكون الاقتران مع الطفرات في مختلف معروف BBS المكاني لتسبب المرض. منذ تستند جميع النماذج BBS على وضع المتنحية من انتقال المرض، والإثراء في عدد السكان نيوفاوندلاند لقابلية مؤسس المهيمن موضعا قد هربوا الكشف.


لا يزال هناك الكثير الذي يمكن تعلمه حول كل من الوراثة والخلل الفسيولوجية في BBS. ما لا يقل عن ثلاثة جينات BBS تبقى uncloned وأكثر عدة مواضع في الجينوم البشري وربما ككل. وبالإضافة إلى ذلك، لا بد من التحقيق في مسألة الميراث متعدد الألائل بدقة، لأنها سوف يكون لها أيضا تأثير كبير على فهمنا لوظيفة البروتينات BBS المختلفة وعلاقتها مع بعضها البعض.
والتوفيق بين النمط الظاهري BBS عديد المظاهر مع الطفرات في مزيج واحد أو الجينات يبقى من الصعب حتى يتم توضيح وظيفة البروتينات BBS. على افتراض أن BBS6 هو chaperonin، يمكن القول أن BBS يسببه عدد من الجزيئات التي تم اختراق بسبب misfolding الوظيفة. رابطة chaperonins النوع الثاني وVHL (61، 62) هي وصلة محيرة للجوانب الكلى من النمط الظاهري. وينطبق الشيء نفسه على α-transducin، ركيزة من chaperonins النوع الثاني (63) الذي فقدان الوظيفة يؤدي إلى انحطاط مبصرة (64).
صياغة الفرضيات وظيفية للBBS2 وBBS4 هو أكثر صعوبة، حيث لا يعرف الكثير عن هذه البروتينات. وأو كليهما الببتيدات مطوية أو التي تدهورت بفعل BBS6؟ أنها لا تتفاعل مع بعضها البعض؟ الأهم من ذلك، أنهم إذا فعلوا المشاركة في نقل الإشارة على النحو الذي اقترحه الزخارف، وما إشارة خارج الخلية أنها لا تحيل وما هو الرد الخلوية لهذه الإشارة؟ إن الأجوبة على هذه الأسئلة وغيرها ذات الصلة توفر رؤى جديدة مهمة في العمليات الخلوية الحرجة لمجموعة متنوعة من الوظائف الخلوية مثل توازن الطاقة وشبكية العين، أطرافهم والتنمية الكلى.

ملاحظة المضافة في PROOF

تحليل طفرية من BBS2 وBBS6 قدم أدلة مؤخرا فرضية أن الطفرات في أكثر من BBS قد تكون هناك حاجة لالمرضية. في دراسة حديثة، Katsanis وآخرون. (65) عن وجود ثلاثة الطفرات المسببة للمرض في أربعة الأنساب BBS. كان واحد نسب اثنين من الطفرات BBS6 وطفرة BBS2 واحد، في حين كان ثلاثة الأنساب اثنين من الطفرات BBS2 وطفرة BBS6 واحد. وعلاوة على ذلك، في عائلة واحدة الفرد يتأثر قد ورثت اثنين من الطفرات BBS2 باطل ولكن كانت من النوع البري لBBS6، في حين أن السيب تتأثر يحمل mutaiton اغية الثالث في BBS6. هذا يؤدي المؤلفين أن أقترح أن لبعض الأنساب، والطفرات في اثنين مواضع ضرورية وكافية لالمرضية. وخلصوا أيضا إلى أن على أساس النمط الفرداني يحلل عبر فترات حرجة من غيرها من مواضع BBS، هذا الوضع "triallelic 'من الميراث ومن المرجح أن تنطوي على الجينات BBS أخرى مثل BBS1 وBBS4.

رافت ابراهيم 11-23-2015 08:31 PM

بارديه-بيدل البروتينات متلازمة السيطرة على طول الأهداب من خلال تنظيم بلمرة أكتين

أهداب الأولية هي الزوائد الخلوية مهمة لنقل الإشارة والاستشعار عن بعد في البيئة. بارديه-بيدل البروتينات متلازمة شكل مجمع وهذا أمر مهم لعدة عمليات تتعلق الهيكل الخلوي مثل تكون الأهداب، والهجرة الخلية والانقسام. ومع ذلك، فإن الآليات التي البروتينات BBS قد تنظيم الهيكل الخلوي لا تزال غير واضحة. اكتشفنا أن Bbs4- وBbs6 الخلايا النخاعية الكلى -deficient عرض السلوك المميز تضم الفقراء والهجرة، والالتصاق والانقسام مع عدم القدرة على تشكيل ملحقات lamellipodial وfilopodial. وعلاوة على ذلك، تم المهدبة خلايا متحولة أقل [48٪ ± 6 لالبرية من نوع (WT) خلايا مقابل 23٪ ± 7 لخلايا فارغة Bbs4؛ P <0.0001] وأهداب بهم كانوا أقصر (2.55 ميكرون ± 0.41 لخلايا WT مقابل 2.16 ميكرون ± 0.23 لخلايا فارغة Bbs4؛ P <0.0001). في حين أن الهيكل الخلوي microtubular والأكتين القشرية كانت سليمة، وتعطل تشكيل ألياف الأكتين الإجهاد الشديد، وتشكيل الشاذة قمي المجاميع الألياف الإجهاد. وعلاوة على ذلك، لاحظنا الالتصاقات البؤرية الإفراط في وفرة (FAS) في Bbs4-، Bbs6- والخلايا -deficient Bbs8. في ضوء هذه النتائج، ودور RhoA في تنظيم خيوط الأكتين البلمرة، أظهرنا أن مستويات RhoA-GTP تم upregulated غاية في غياب البروتينات BBS. على علاج Bbs4 خلايا -deficient مع مثبطات الكيميائية للRhoA، كنا قادرين على استعادة طول الأهداب وعدد وكذلك سلامة الهيكل الخلوي الأكتين. معا هذه النتائج تشير إلى أن البروتينات BBS تلعب دورا مركزيا في تنظيم الهيكل الخلوي الأكتين والسيطرة على طول الأهداب من خلال تغيير في مستويات RhoA.

أهداب الأولية هي الزوائد قمي الانفرادي موجودة على معظم الخلايا في الجسم. الأدلة الأخيرة حددت أنهم بعيدون عن أثري، بدلا يعمل كما هوائيات لنقل الإشارة. العمليات التي تنظم تكون الأهداب والإشارات بدأت بالظهور، إلى حد كبير نتيجة لدراسة نماذج الأمراض الحيوانية واضطرابات الإنسان.
متلازمة بارديه-بيدل (BBS) هو عديد المظاهر السريرية، واضطراب وراثي جسمي مقهور في المقام الأول يتألف من السمنة، والتقدمية تنكس الشبكية المبكر يصيب، polydactyly، نقص الأعضاء التناسلية وضعف الإدراك والنمو الشاذ الكلى (1 - +4). وقد ارتبط هذا التناذر غير متجانسة مع الطفرات في لا يقل عن 15 BBS الجينات المسببة لل(5). ترتبط البروتينات وما شابه ذلك لالهدبي، الجسم القاعدية أو اختلال وظيفي centrosomal وبعض وقد ثبت أن تعدل النقل intraflagellar (IFT) (6). ومع ذلك، فإن الآليات الجزيئية الدقيقة لهذه الإجراءات لا تزال بعيدة المنال.
نحو فهم أفضل لدور البروتينات BBS في وظيفة الخلوية، وأظهرنا سابقا أن BBS4 مطلوب للIFT الوراء من مكونات centrosomal الرئيسية مثل PCM1 (مطلوب لتشكيل أهداب)، وبالتالي يتصرف بوصفه البروتين محول لتحميل البضائع على داينين المحركات الجزيئية (7). نحن أول من اقترح وظيفة الهدبية للبروتينات BBS بعد اكتشاف BBS8، وهو بروتين وهو ما يعبر عنه في ظهائر مهدبة والخلايا العصبية المهدبة في انواع معينة ايليجانس. وقد ثبت BBS7 وBBS8 لتنسيق المحركات الجزيئية خلال IFT في C. ايليجانس (6). كشفت دراسة تنقية جنبا إلى جنب تقارب أن سبعة البروتينات BBS (BBS1، BBS2، BBS4، BBS5، BBS7، TTC8 / BBS8 وBBS9) تشكل المعقدة (ويشار إلى أن BBSome)، والمشاركة في نقل حويصلي الخلايا في تركيبة مع Rab8a، وهي مطلوب مباشرة لتكون الأهداب (8). هناك وظائف الجزيئية الأخرى المقترحة للبروتينات BBS، مثل دور البروتينات BBS في كل من غير المقبول والمتعارف عليها إشارات Wnt (9، 10). ومؤخرا، على ضرورة DISC1 الفسفرة محددة لتجنيد البروتينات BBS إلى الجسيم المركزي وفقدان BBS1 يؤدي إلى عيوب في هجرة الخلايا العصبية، وإن كان بعض الآليات الجزيئية وغير معروف (11).
نحن ذكرت مؤخرا ان morphants الزرد bbs8 زيارتها المعيبة العصبية الهجرة الخلية قمة كما تفعل BBS8 خلايا -depleted، مشيرا إلى أن هناك حاجة أيضا البروتينات BBS لحركية الخلية (12). للحصول على فهم أفضل للآليات الأساسية المسؤولة لهذه العيوب الخلوية على ما يبدو أهداب المستقلة، درسنا آثار BBS استنزاف البروتين على الهيكل الخلوي الخلوي.
يبدو تنظيم الهيكل الخلوي أكتين أن يكون لها دور رئيسي في اثنين على الأقل من السمات الأساسية للBBS. لعسر تصنع الكلى، فقد أفيد لتنظيم الكلوي تكون الكيسة وخلية رجلاء ديناميات (+13 - 15). وعلاوة على ذلك، هناك أدلة قوية على الجينات المسؤولة عن تنكس الشبكية، مثل RPGR، التي تنظم تشكيل أهداب والاستقرار الأكتين (16).
هنا، ونحن التقرير أن Bbs4- وBbs6 الخلايا النخاعية الكلى -deficient تهاجر نحو رديء، تحمل أهداب أقل وأقصر ولها الهيكل الخلوي الأكتين التي تأثرت بشدة. وعلاوة على ذلك، لاحظنا على مدى وفرة الالتصاقات البؤرية (FAS) في Bbs4-، Bbs6- وBbs8 خلايا -deficient مرتبطة بزيادة مستويات مستويات RhoA-GTP. على علاج Bbs4 خلايا -deficient مع مثبطات ممر RhoA، كنا قادرين على استعادة طول الأهداب وعدد وكذلك سلامة الهيكل الخلوي الأكتين. نقترح دورا جديدا للبروتينات BBS في تنظيم الهيكل الخلوي الأكتين التي بدورها تنظم مجموعة واسعة من الوظائف الخلوية لشرح النمط الظاهري واسعة الطيف المرتبطة مع العديد من ciliopathies.


عرض BBS التي تعاني من نقص خلايا الكلى الحركة والانقسام السيتوبلازمي العيوب

في ضوء الملاحظات السابقة لدينا حيث يطلب من البروتينات BBS لحركية خلية في الزرد، ونحن التحقيق في سلوك الخلوي للخلايا النخاع الكلى المأخوذة من Bbs4 - / - وBbs6 - / - الفئران (17، 18). في حالة غير متموجة، Bbs4 - / - وBbs6 - / - أظهرت الخلايا الأولية تأخر الحركة والانقسام والانقسام السيتوبلازمي وكانت بطيئة لأعد إلى الركيزة بعد الانقسام، ونحن سبق وصفه في خلايا BBS8 متحولة الإنسان (12) (الشكل . 1 A). على توثيق التفتيش، كان واضحا أن الخلايا الطافرة شكلت اعتقلت مجموعات مع ندرة أقدام صفاحية أو أرجل كاذبة خيطية، من المرجح أن تؤثر على قدرتها على الهجرة (الشكل 1التكميلية المادة، أفلام 1-3). اختبرنا المقبل سلوك خلايا متكدسة في الصفر ('التئام الجروح') المقايسات. كما كانت الهجرة المتوقع المعيبة في Bbs4 - / - وBbs6 - / - ثقافات مقارنة مع فحوصات السيطرة (الشكل 1 B و C). هذه البيانات متفقة مع الملاحظات السابقة للخلايا -depleted Bbs8 (12).
الشكل 1.
خلايا متحولة BBS تفتقر التنقل. (A) الأطر الزمنية الفاصل بين من خلايا الكلى غير متموجة. Bbs4 خلايا الكلى -deficient (رأس السهم الأبيض) لديها ندرة lamellopodia وأرجل كاذبة خيطية والهجرة بطيئة (انظر المواد التكميلية، فيلم 1). شريط نطاق 50 ميكرون. (B) Phalloidin (أحمر) ودابي (الأزرق) تلطيخ يظهر فحص التئام الجروح. مقارنة مع خلايا WT، تظهر Bbs4 وBbs6 خلايا فارغة الهجرة قصور وتأخر إغلاق الجرح. شريط على نطاق واسع 200 ميكرون. شريط صغيرة الحجم 50 ميكرون. (C). منطقة الانتعاش بعد فحص التئام الجروح. خلايا WT عرض مبلغا أكبر من سطح تعافى (286400 ميكرون 2) أو 86٪ من إغلاق الفجوة، بينما Bbs4 وBbs6 خلايا فارغة التعافي فقط 253500 ميكرون 2 و 255700 ميكرون 2 أي ما نسبته 74٪ و 75٪ من الإغلاق التام. WT مقابل خلايا متحولة Bbs4 P <0.001، WT مقابل Bbs6 خلايا متحولة P <0.001.

مطلوبة البروتينات BBS لتنظيم هيكل الخلية أكتين

لتحديد أساس عدم وجود تمديد lamellopodial والهجرة الخلية، ونحن التحقيق بجانب الهيكل الخلوي في الخلايا الليفية متحولة. ومن المثير للاهتمام، ونحن لم يكشف عن أي خلل في الهياكل microtubular على المناعية من tubulins (لا تظهر البيانات). نحن الملون بجانب هذه الخلايا مع phalloidin. في حين البرية من نوع (WT) خلايا عرضت ألياف الأكتين الإجهاد موازية تعقد بانتظام، لم تراع هذه في Bbs4 - / - وBbs6 - / - الخلايا. وعلاوة على ذلك، ونحن أيضا لاحظ الفوضى الإجمالي من الهيكل الخلوي الأكتين، وخاصة في المنطقة القمية من Bbs4 - / - وBbs6 - / - خلايا متكدسة (الشكل 2 A). ولوحظ وجود النمط الظاهري مشابهة جدا عندما يتم استنفاد Bbs8 بواسطة shRNAs في الخلايا NIH3T3 (الشكل 2 B)، كما هو موضح سابقا في (12). هناك يبدو أن الإفراط في وفرة من ألياف الإجهاد المحلية، حيث يبدو حزم من خيوط الأكتين أن ترتكز على الغشاء. خيوط الأكتين شكلت خطي مميزة مثل محور ميزة (19) مع الألياف الصغيرة المنبثقة عمودي على حزمة الألياف الرئيسية، تختلف تماما لترتيب نموذجي في خلايا WT، كما هو موضح في الشكل 2 C.
الرقم 2.
BBS الخلايا المنضب لديها الهيكل الخلوي أكتين معيب. (A و B) Phalloidin (أبيض) ودابي (الأزرق) تلطيخ (A) Bbs4- وBbs6 خلايا الكلى الأولية -deficient تنتج المجاميع أكتين في المنطقة القمية للخلية، مقارنة مع الخلايا WT. تظهر رؤوس سهام المجاميع أكتين على apically في الخلية (الأسهم الخضراء). (B) وبالمثل، خلايا NIH3T3 المنضب لBbs8 تظهر تعطل الأكتين مماثل بالمقارنة مع خطوط خلايا غير transfected. شريط النطاق الأبيض 20 ميكرون. أسود شريط نطاق 50 ميكرون (السهم الأخضر). (C) Phalloidin (الخضراء) ودابي (الأزرق) تظهر تلطيخ أن خيوط الأكتين الشاذة تنشأ من غشاء الخلية. التمثيل التصويري تبين درجات مختلفة من بلمرة خيوط الأكتين متفرعة حديثا ينتهي، وتشكيل هيكل يشبه مركزا على قمة الخلية. شريط نطاق 20 ميكرون. (D) لقطات من أكتين-GFP transfected WT وBbs4 خلايا -deficient (انظر المواد التكميلية والأفلام 3 و 4 و 5)، والتي تبين تجميع الأكتين على قمة خلايا فارغة Bbs4. صور إعادة الإعمار متحد البؤر (E) 3D تظهر المنظمة الأكتين في WT وBbs4 خلايا فارغة في التعليق التالي تلطيخ مع رودامين-phalloidin. لم تكن هناك اختلافات واضحة في تنظيم الأكتين القشرية بين Bbs4 - الخلايا وWT - /.

من أجل التحقيق في كيفية هذه الباقات شكلت في الجسم الحي، WT وBbs4 - / - و transfected الخلايا للتعبير عن الأكتين-GFP. اتخذت متحد البؤر الأفلام الوقت الفاصل بين ووحظت التراكمات الأكتين تشكيل في القرب من غشاء الخلية في الجانب قمي للخلية. وبالتالي قد تكون هذه المجاميع بمثابة المراسي، وتعطيل وظيفة طبيعية من الهيكل الخلوي كله (الشكل 2 C والمواد التكميلية، أفلام 4-6).
لاختبار ما إذا كان هذا النمط الظاهري الأكتين مستقلة من التفاعل خارج الخلية، قمنا بتحليل الأكتين في الخلايا في التعليق. وعلى النقيض من الخلايا الملتصقة، لم يكن هناك اختلاف في تنظيم الأكتين بين WT وBbs4 - / - الخلايا، وكلا عرضت توزيع القشرية منقط مماثل (الشكل 2 D). من أجل مزيد من الدراسة سلامة الأكتين القشرية في الخلايا BBS-ناقص، استخدمنا تقنية تطلع micropipette على الخلايا مع وقف التنفيذ. طموح Micropipette هو الاسلوب الذي يقيس الميكانيكا الحيوية من الغشاء الخلوي. تطبيق التحميل الميكانيكية يؤثر على تنظيم الأكتين من الغشاء، مما يسمح لنا لدراسة معدل الاسترداد والتي تعتمد على ديناميات البلمرة أكتين. يوفر هذا الأسلوب راسخة تقديرا لمعامل الخلايا الإجمالي الذي يعتمد على سلامة وديناميات الهيكل الخلوي الأكتين (20). في هذا الإعداد، تعطلت الأكتين القشرية بعد العلاج مع نتائج مثبط حركة الخلايا D في تشويه للخلية في micropipette، وتتميز انخفاض في معامل التوازن الخلية (21). WT وBbs4 - / - الخلايا، مع أو بدون ترنسفكأيشن مع أكتين-GFP (لاستبعاد أي تأثير الأكتين على التعبير)، تم تحليلها في نظام الطموح pipetting لالجزئي (. المواد التكميلية، الشكل S1 والتكميلية المادة، أفلام 7 -10). لم نعثر على أي اختلاف في معامل التوازن بين WT وBbs4 - / - الخلايا، أو بين الخلايا المصابة بالعدوى بالنقل أو untransfected (الشكل 3 B). وتشير هذه البيانات إلى أن النمط الظاهري يتعلق فقط إلى تكوين ألياف التوتر بدلا من تنظيم الأكتين القشرية. لاختبار هذا، ونحن المصنف الخلايا وثابتة لهم، بعد تمسكهم الركيزة، تلطيخ لهم phalloidin-رودامين. أولا، لاحظنا تشكيلات الأكتين الشاذة في Bbs4 - / - الخلايا في بداية ألياف الإجهاد البلمرة (الشكل 3 A). ثم، حسبنا النسبة المئوية للخلايا في كل مجال تقديم ملحقات lamellopodia التي تعتمد على الأكتين في 3 و 4 و 5 ساعة بعد البذر الخلايا. يتم زيادة النسبة المئوية للخلايا تقديم lamellopodia في كل نقطة زمنية، كما هو متوقع. ومع ذلك، لاحظنا أقل ملحقات في خلايا فارغة Bbs4، مقارنة مع الخلايا WT (الشكل 3 C).
الرقم 3.
النمط الظاهري الأكتين هيكل الخلية يعطل البلمرة أكتين حشوية ولكن ليس الأكتين القشرية. (A) خلايا تمتد lamellopodia 5 ساعات بعد البذر. كانت ملطخة F-الأكتين مع phalloidin لإظهار ألياف الإجهاد تشكيل. بعد 5 ساعات، Bbs4 - / - خلايا كانت قد بدأت تتشكل خيوط الأكتين بلمرة خطأ (رأس السهم). (B) Micropipetting الخلايا مع وقف التنفيذ لم تظهر أي فروق ذات دلالة إحصائية في معامل التوازن بين الخلايا -deficient WT وBbs4 أو بين Bbs4 خلايا -deficient والخلايا -deficient Bbs4 تعامل مع مثبط Y27632 RhoA (مان-ويتني اثنين من الذيل، P> 0.05). (C) النسبة المئوية للخلايا في كل مجال الرؤية التي تحتوي على مجموعات الخلايا خلية / تطوير ملحقات lamellopodia. علقت WT وBbs4 - / - تم المصنف coverslips على وتم إصلاحها 3 و 4 و 5 ساعات بعد ذلك. وBbs4 - / - الخلايا لديها نسبة إحصائية بدرجة كبيرة من الخلايا مع lamellopodia في كل نقطة زمنية [-values ​​P لمدة 3 ساعات (P <0.027)، 4 ح (P <0.0185) و 5 ح (P <0.0277)] postseeding .

راقبنا بجانب انتعاش الأكتين التالية التحلل باستخدام مثبط حركة الخلايا دقائق D. عشرون بعد العلاج، لاحظنا تأخر والانتعاش الشاذة من الهيكل الخلوي الأكتين في Bbs4 - / - خلايا الفئران الطافرة مقارنة مع الضوابط (المواد التكميلية، الشكل S2.). على ترنسفكأيشن من خلايا mIMCD3 مع Bbs4 وBbs6 كامل طول بنيات التعبير (pCMV-Bbs4-HA وpCMV-Bbs6-cmyc)، اكتشفنا فشل خيوط الأكتين البلمرة بالمقارنة مع خلايا untransfected (الشكل 4)، لافتا نحو دور كابح خلال البلمرة أكتين. وتشير هذه النتائج إلى أن مستويات البروتين BBS ومتوازنة بدقة لتنظيم تشكيل ألياف الأكتين.
الرقم 4.
أدى overexpression من Bbs4 -HA وBbs6 -cmyc يبني تلطيخ Phalloidin-رودامين (الصفراء) وoverexpression من Bbs4 -HA وBbs6 -myc الموسومة (أبيض) (A) overexpression من Bbs4-HA أو Bbs6-MYC في البلمرة ناقصة من cytoplasmatic F -actin (arrohead أبيض)، مما يعوق بلمرة خيوط الأكتين، مقارنة مع الخلايا untransfected المجاورة (السهام البيضاء). تلك mIMCD3 خلايا متكدسة untransfected (السهام البيضاء) تظهر النمط العادي للألياف الإجهاد. (B) ترنسفكأيشن مع فارغة البلازميدات السيطرة هكتار أو ج myc لا يعطل البلمرة، ويتم بلمرة خيوط الأكتين بشكل صحيح. شريط نطاق 20 ميكرون.

يتم التعبير عن Bbs8 وBbs9 في الالتصاقات البؤرية ويترافق مع زيادة بلمرة الأكتين

وقد وصفت BBSome ومجمع من سبعة جينات BBS المطلوبة لتكون الأهداب التي BBS4 هي مجرد واحدة من المكونات (8، +22 - +24). وبالتالي فإننا التحقيق شركاء BBSome الآخرين، Bbs8 وBbs9، للقيام بأدوار المفترضة في تنظيم الأكتين. نحن مصممون التوزيع غير متوقع من Bbs8 وBbs9 في محيط الخلية، واصفة خيوط الخطية تشبه الأكتين (الشكل 5 A). لم هذه البروتينات لا التسمية بالاشتراك مع F-الأكتين ولكن بدلا من ذلك تم المرتبطة بشكل وثيق مع Vinculin التي بقع على وجه التحديد اتفاقات الصيد (الشكل 5 B و D). نحن أيضا لاحظ الجسيم المركزي / القاعدية توطين جثة Bbs8 وBbs9 في متموجة خلايا mIMCD3، بالإضافة إلى التعبير FA.
الرقم 5.
يتم التعبير عن Bbs8 وBbs9 في اتفاقات الصيد. يتم التعبير (A) Bbs8 وBbs9 في السيتوبلازم بطريقة شعاعي (السهام البيضاء) في الخلايا mIMCD3 الهجرة غير متموجة. شريط نطاق 20 ميكرون. وcoexpressed (B و C) كل من Bbs8 وBbs9 مع vinculin في اتفاقات الصيد. شريط نطاق 20 ميكرون. (D) Bbs8 وBbs9 توطين في بداية خيوط F-أكتين (رأس السهم). شريط نطاق 20 ميكرون. (E) لاحظ أن اتفاقات الصيد تتمركز في Bbs4- والخلايا ناقصة Bbs8- (السهام) مقارنة مع الخلايا WT حيث اتفاقات الصيد وغلبة في محيط الخلية (السهام). شريط نطاق 20 ميكرون. Vinculin تلطيخ للاتفاقات الصيد. النشاط (F) RhoA في خطوط BBS التي تعاني من نقص. ارتفاع كبير في مستويات المنشط RhoA في خلايا متحولة، على سبيل المثال هناك زيادة بنسبة 2 أضعاف للخلايا فارغة Bbs6 (SEM ± 0.07)؛ 2.5 أضعاف لخلايا فارغة Bbs4 (SEM ± 0.12) و 2.6 أضعاف لBbs8 -shRNA استنزاف الخلايا (SEM ± 0.09). بيانات تطبيع للنشاط WT RhoA. (G-J) الكمي لنسبة الأكتين F / G في Bbs8 -shRNA المنضب خلايا NIH3T3 وBbs4 خلايا الكلى لاغية الأساسي. استخدمت Phalloidin-رودامين والدناز I-اليكسا 488 لقياس مضان المنبعثة وحساب النسبة. وهذه النسبة أعلى في خطوط الخلايا الطافرة (WT 1.54 ± 0.28 مقابل Bbs4 باطل 1.96 ± 0.24؛ P <0.001 shRNA السيطرة 0.65 ± 0.17 مقابل Bbs8 -shRNA 1.12 ± 0.21؛ P <0.001). *** P <0.001. شريط نطاق 20 ميكرون.

اتفاقات الصيد هي مجمع محددة جيدا من البروتينات التي تصل المصفوفة خارج الخلية مع الهيكل الخلوي الأكتين ولعب دورا نشطا في الحركة الخلوية والأكتين البلمرة (إعادة النظر في (25)). وينظم شبكة الأكتين في أقدام صفاحية، أرجل كاذبة خيطية والإجهاد الألياف كبير من قبل اتحاد كرة القدم، وترتكز ألياف الأكتين الإجهاد في كرة القدم (25). يتم التعبير عن Bbs8 وBbs9 يبدو أن تلك النقطة التي يتم فيها بلمرة خيوط الأكتين (الشكل 5 D والتكميلية المواد، الشكل S3)، مما يدعم الافتراض المسبق لدينا التي تشارك البروتينات BBS في تنظيم الأكتين. لم يوجد فرق في توطين Bbs8 وBbs9 في Bbs4 - / - أو Bbs6 - / - الخلايا (. المواد التكميلية، الشكل S4 و S5)، ودعم فكرة أن Bbs4 هي المكون الأخير تجميعها في BBSome (26) وهذا النمط الظاهري وجدت في Bbs4 - / - وBbs6 - / - الخلايا لا يرجع إلى BBSome mislocalization كله.
هذه الملاحظات مع العيوب الهجرة في خلايا متحولة BBS تشير وجود صلة بين BBS، البلمرة أكتين وFA. لذا قمنا بحساب عدد فاس لكل خلية موجودة في غير متموجة-Bbs4 - / - خلايا الكلى الأولية والخلايا NIH3T3 ناقصة لBbs8 (shRNA) (12). في المتوسط، لاحظنا أن عدد فاس كان أعلى في الخلايا -deficient BBS مقارنة مع الضوابط (126 ± 8.725 N = 15 لBbs4 - / - خلايا مقابل 104.9 ± 3.867 N = 15 لخلايا WT: P <0.05) و (106 ± 4.057 N = 15 لخلايا Bbs8 shRNA مقابل 85.79 ± 2.158 N = 15 لخلايا تحكم؛ P <0.001)، من المحتمل تؤثر والتداخل مع الحركة الطبيعية للخلايا. وعلاوة على ذلك، قمنا بتحليل مسافة كل اتفاقات الصيد إلى غشاء في كل نوع من الخلايا الاكتشاف الذي Bbs4 - / - الخلايا والخلايا Bbs8 shRNA لديها اتفاقات الصيد توزيع أكثر مركزيا (6.594 ميكرون ± 0.1011 N = 123 لBbs4 - / - خلايا مقابل 5.406 ميكرون ± 0.2358 N = 107 للخلايا WT؛ P <0.001، وميكرون 13.02 ± 0.3518 N = 101 للخلايا Bbs8- shRNA مقابل 10.49 ميكرومتر ± 0.3521 N = 92 لخلايا تحكم؛ P <0.001). (الشكل 5 E والتكميلية المواد، الشكل. S6).
لاختبار هذه الفرضية أيضا، تم احتساب النسبة بين G-الأكتين وF-الأكتين في الخلايا متحولة مقارنة مع الضوابط. عن طريق قياس كثافة مضان النسبية phalloidin-رودامين (F-الأكتين) وDnaseI-488 (G-الأكتين) (الشكل 5 G-J)، وجدنا زيادة كبيرة في مستويات F-أكتين في Bbs4 - / - وBbs8 -shRNA خلايا تدل على زيادة في بلمرة الأكتين في الخلايا متحولة.

وبوساطة العيوب التحلل الأكتين وتكون الأهداب عن طريق زيادة النشاط RhoA الخلوي في خلايا متحولة BBS

وتشارك RhoGTPases في تنظيم ديناميات الأكتين وتشكيل فاس (19، 27، 28)؛ ولا سيما زيادة في النشاط النتائج RhoA في زيادة التجمع FA والبلمرة F-أكتين. للتحقيق في سبب زيادة مستويات FA، قمنا بقياس مستويات نشط RhoA-GTP باستخدام الفحص المناعي المرتبط بالإنزيم في Bbs4 - / - وBbs6 - / - خلايا الكلى والخلايا Bbs8 -shRNA NIH3T3. ولوحظ وجود زيادة كبيرة في نشاط RhoA في الخلايا BBS المنضب بالمقارنة مع WT، وبالتالي يحتمل شرح الزيادة في تشكيل الاتحاد الانجليزي والبلمرة F-أكتين (الشكل 5 F).
بشكل جماعي، وتشير كل هذه المعطيات وجود صلة قوية بين الجينات BBS وتنظيم الأكتين هيكل الخلية البلمرة، التي ارتبطت في السابق مع تكون الأهداب (29). بعد تحديد سبب من الهيكل الخلوي الأكتين تعطلت، نحن شكك بجوار طبيعة العلاقة مع هدب الابتدائي وظيفة الهدبية. نحن التحقيق أهداب الابتدائي في Bbs4 - / - خلايا الكلى مشيرا الى انخفاض عدد كبير من الخلايا المهدبة (23٪ Bbs4 - / - مقابل 48٪ WT؛ P <0.001) بعد المجاعة في الدم وانخفاض في متوسط ​​طول أهداب مقارنة مع الشاهد الخلايا (الشكل 6 A-C). على علاج Bbs4 - / - الخلايا مع مثبط حركة الخلايا D، ونحن أيضا لوحظ استعادة كبيرا في أعداد طبيعية من الخلايا المهدبة ويصاحب ذلك زيادة في متوسط ​​طول الأهداب (الشكل 6 A-C). وتشير النتائج التي توصلنا إليها أن الجينات BBS تنظم تكون الأهداب من خلال تنظيم الهيكل الخلوي الأكتين، وهذه النتائج متسقة مع دراسة حديثة تربط جهري تكون الأهداب مع ديناميات الأكتين، حيث تعطل الهيكل الخلوي الأكتين الترويج تكون الأهداب (29).
الرقم 6.
استرداد عدد أهداب التالية التحلل (A). السيطرة ومثبط حركة الخلايا D تعامل WT وBbs4 الخلايا الأولية الكلى فارغة. منظر عام لميدان متكدسة وأهداب ممثل (الشكل). المعاملة مع مثبط حركة الخلايا D يسترد أرقام أهداب وطول في خلايا فارغة Bbs4 (رأس السهم الأبيض) مقارنة مع الخلايا WT (السهام البيضاء). شريط نطاق 20 ميكرون. أقحم مقياس شريط 10 ميكرون. (B) التمثيل البياني للطول أهداب الخلايا فارغة WT وBbs4 المعالجة وغير المعالجة. الخلايا غير المعالجة WT (2.55 ميكرون ± 0.41)، وخلايا WT المعالجة (4.67 ميكرون ± 0.53)، وخلايا فارغة Bbs4 غير المعالجة (2.16 ميكرون ± 0.23)، وتعامل خلايا فارغة Bbs4 (7.58 ميكرون ± 0.62). (C) النسبة المئوية للخلايا مهدبة فيما يتعلق العدد الكلي للخلايا. الخلايا غير المعالجة WT (48٪ ± 6.1)، وخلايا WT المعالجة (51٪ ± 3.2)، الخلايا غير المعالجة Bbs4 فارغة (23.01٪ ± 7.02)، وتعامل خلايا فارغة Bbs4 (49.29٪ ± 3.9). لاحظ أنه لا توجد زيادة في نسبة الخلايا المهدبة WT بعد العلاج مع مثبط حركة الخلايا (D)؛ ومع ذلك تعامل خلايا فارغة Bbs4 التعافي إلى مستويات WT. *** P <0.001، * P <0.05، نانوثانية. أهمية not-.

للتحقيق في ما إذا كانت زيادة النشاط RhoA قد توسط هذه العيوب التي تعتمد على الأكتين في تكون الأهداب، عرضنا Bbs4 - / - الخلايا الظهارية الكلوية لاثنين RhoA مثبطات ممر، Y27632 (مثبط محدد من رو المصاحب ملفوف لفائف تشكيل البروتين سيرين / ثريونين كيناز (ROCK) أسرة من تحركات البروتينات) وC3 ترانسفيراز (وهو إنزيم براني الذي يمنع المجال RhoA المستجيب ملزم للGTPase على وجه التحديد). ونتيجة لذلك وبما يتفق مع النتائج التي توصلنا إليها، أهداب تطول وزيادة عدد الخلايا المهدبة بشكل ملحوظ (الشكل 7 A-C والتكميلية المواد، الشكل. S7A وB). تم العثور على إنقاذ مماثل للطول الأهداب وأهداب عدد عندما Bbs6 - تعرضت الخلايا لY27632 - / (الشكل 7 D و E). ومن المثير للاهتمام، ونحن أيضا لوحظ إطالة أهداب الخلايا السيطرة. وعلاوة على ذلك، وعلاج Bbs4 - / - الخلايا مع Y27632 وC3 ترانسفيراز تشكيل تحول دون ألياف الإجهاد قمي (30) (الشكل 7 F والمواد التكميلية، الشكل 7C.). ولوحظ وجود ما يصاحب ذلك انخفاض 2 أضعاف في مستويات RhoA تنشيط (الشكل 7 G والمواد التكميلية، الشكل 7D).
الرقم 7.
تثبيط مسار RhoA مع Y27632 ينقذ الهيكل الخلوي الأكتين وطول الأهداب في الخلايا فارغة Bbs4. كانت (A و B) سيليا من WT المصل تجويع الخلايا المعالجة مع Y27632 أطول (4.256 ميكرون ± 0.2367) من الخلايا غير المعالجة (2.746 ميكرون ± 0.1527). وبالمثل في Y27632 تعامل خلايا فارغة Bbs4، كانت أهداب الخلايا تقريبا ضعف المدة غير المعالجة كما (3.429 ميكرون ± 0.2355 مقابل 1.923 ميكرون ± 0.1321؛ P <0.001). شريط مقياس مكون من 5 ميكرون. (C) عدد مهدبة خلايا فارغة Bbs4 (43٪ ± 1.95) يتعافى إلى مستويات WT (54٪ ± 0.99) عندما تعامل مع Y27632، P <0.0001. (D) نتيجة مماثلة تم الحصول عليها عندما تم علاج خلايا فارغة Bbs6 مع Y27632. كانت أهداب مرة أخرى لفترة أطول WT المعاملة (4.276 ميكرون ± 0.04531 N = 29) من الخلايا غير المعالجة (2.883 ميكرون ± 0.04899 N = 32). وبالمثل في Y27632 تعامل خلايا فارغة Bbs6، أهداب يتضاعف طول مقارنة مع الخلايا غير المعالجة (3.445 ميكرون ± 0.1529 N = 31 مقابل 1.224 ميكرون ± 0.08055 N = 24؛ P <0.001). (E) عدد مهدبة خلايا فارغة Bbs6 (16٪ ± 1.38) يتعافى إلى مستويات WT (44٪ ± 0.99) عندما تعامل مع Y27632، P <0.0001. (F) هناك انخفاض في تشكيل مجموع الألياف الإجهاد في خلايا فارغة Bbs4 بعد التعرض لY27632. مقياس شريط 30 ميكرون. النشاط (G) RhoA من الخلايا المعالجة مع 10 م م Y27632 لمدة 30 دقيقة. تم تطبيع كافة البيانات عن النشاط WT RhoA. بعد العلاج، تم تخفيض مستويات تنشيط RhoA إلى النصف في الخلايا WT المعاملة (0.4614 ± 0.05629). وجدنا نفس الحد من النشاط RhoA في خلايا فارغة Bbs4، من 1.788 ± 0،095-،7475 ± 0.0053. *** P <0.001.

عندما Bbs4 - / - تم علاج الخلايا في تعليق مع Y27632، تم حساب معامل التوازن التالية تقنية تطلع micropipette. لم يتم العثور على الفرق بين المعالجة وغير المعالجة في Bbs4 - / - الخلايا (الشكل 3 A). وهذا يشير إلى أن الإنقاذ لوحظ في الخلايا الملتصقة غير محددة لدور Bbs4 في ألياف الإجهاد وليس هو المسؤول عن اضطراب طبيعة الأكتين القشرية.
من أجل التحقيق في ما إذا كان تفعيل RhoA قد تكون ذات صلة الظواهر الموجودة في BBS، نحن اختبار ما إذا كان تثبيط RhoA بعد العلاج مع Y27632 يمكن إنقاذ الأجنة الزرد التي BBS الجينات كانت طرقت إلى أسفل. وقد استخدمت الزرد نطاق واسع لنموذج ciliopathies، وكما نحن وغيرنا قد ذكرت سابقا (17، 31، 32)، وجدنا أن ضربة قاضية من bbs6 أو bbs9 باستخدام أسفرت morpholinos التحقق من صحتها من قبل في الظواهر الهدبية نموذجية، بما في ذلك انحناء الجسم غير طبيعي، وعيون صغيرة والكلوية (سليفة الكلوة) الخراجات. نحن أيضا اختبار bbs4 وbbs8 morpholinos، ولكن وجدت أن الظواهر الناتجة كانت أقل اتساقا، وذلك ركزنا جهودنا لاحقة على bbs6 وbbs9. لأن علاج الأجنة الزرد مع Y27632 من المراحل الأولى للتنمية قاتلة (33)، اخترنا لعلاج الأجنة 24-48 ساعة بعد الإخصاب (HPF) باستخدام محلول مخفف من 100 ن م، وبعد ذلك كانت المخدرات washed- من والأجنة سمحت لتطوير حتى 4 أيام بعد الإخصاب.
استخدمنا العديد من المعلمات لقياس تأثير RhoA تثبيط على BBS morphants، بما في ذلك القطر من العين، وزاوية انحناء الجسم ومجال الخراجات سليفة الكلوة. وجدنا أن العلاج مع Y27632 أسفرت عن استرداد جميع الجوانب الثلاثة من النمط الظاهري. لmorphants bbs6 تعامل مع Y27632، لاحظنا انتعاشا 43٪ من القطر العين (39.66 ميكرون مقابل 56.74 ميكرون؛ P <0.0001) مقارنة مع morphants المعالجة السيارة، انحناء خفض الجسم (11.52 ° مقابل 4.072 °؛ P = 0.0176) و انخفاض معتدل في مجال الخراجات سليفة الكلوة (21.54 ميكرون 2 مقابل 14.30 ميكرون P = 0.0407). تم العثور على نتائج مماثلة لmorphants bbs9 قطر العين (44.07 ميكرون الإقليم الشمالي مقابل 79.18 ميكرون؛ P <0.0001)، انحناء الجسم (9،682 ° الإقليم الشمالي مقابل 3.993 °؛ bbs9 الإقليم الشمالي مقابل bbs9 ر P = 0.038) ومنطقة الكيسي (17.89 ميكرون 2 الإقليم الشمالي مقابل 9.131 ميكرون 2؛ bbs9 الإقليم الشمالي مقابل bbs9 ر؛ P = 0.0038 -value) (الشكل 8 والتكميلية المواد، الشكل 9.). كما وجدنا أن هناك انتعاشا في عرض القطع البدنية النمطية (bbs6 مو 30.0 ميكرون ± 1.19 مقابل مو bbs6 تعامل 43.0 ميكرون ± 0.668 وbbs9 مو 43.9 ميكرون ± 0.914 مقابل bbs9 مو تعامل 49.6 ميكرون ± 0.849)، والتي تتطلب بشكل خاص على درجة عالية نظمت الأكتين الهيكل الخلوي، رغم عدم وجود تغيير كبير في الزاوية التي شكلتها و somites (المواد التكميلية، الشكل 10).
الرقم 8.
الكمي من القطر العين، وزاوية الجسم ومنطقة الكيس سليفة الكلوة في تعامل bbs6 وbbs9 morphants. (A) تمثيل المقاييس المستخدمة لتحديد النمط الظاهري الزرد. اتخذت: ثلاثة قياسات مختلفة في 4 DPF الأجنة قطر العين من بطني لالظهرية، مجال الخراجات سليفة الكلوة إذا كان موجودا وزاوية من أعلى نقطة في جنين والجسم يعود إلى تمثيل للانحناء الجسم. ثم قارنا Y27632 morphants المعالجة وغير المعالجة مع اختبار ر -student. (B - D) الرسوم البيانية شريط تمثل آثار التعرض Y27632. (B) العلاج لا يؤثر على انحناء الأجنة WT (4،355 ° الإقليم الشمالي مقابل 5.198 ° ر)، وفي الوقت نفسه زاوية الجسم من bbs6 (11.52 ° الإقليم الشمالي مقابل 4.072 ° ر) وbbs9 (9،682 ° الإقليم الشمالي مقابل 3.993 ° ر) في المعالجة يتم استرداد الأجنة إلى المستويات العادية. (C) هناك انخفاض معتدل ولكن كبير في المنطقة التي الخراجات غطت في bbs6 المعالجة (21.54 ميكرون 2 الإقليم الشمالي مقابل 14.30 ميكرون 2 ر) وbbs9 (17.89 ميكرون 2 الإقليم الشمالي مقابل 9.131 ميكرون 2 ر) morphants. (D) وقطره العين لا يتأثر في الأجنة WT المعالجة (91.10 ميكرون الإقليم الشمالي مقابل 89.41 ميكرون ر)، ولكن يتم استرداد في bbs6 المعالجة (39.66 ميكرون الإقليم الشمالي مقابل 56.74 ميكرون ر) وbbs9 morphants (44.07 ميكرون الإقليم الشمالي مقابل 79.18 ميكرون ر). أرقام الأجنة WT لا تعامل ن = 52، morphants bbs6 الأجنة لا تعامل ن = 59، morphants bbs9 الأجنة لا تعامل ن = 51، وتعامل WT الأجنة ن = 43، bbs6 morphants الأجنة تعامل ن = 48، bbs9 morphants الأجنة تعامل ن = 43. P -values ​​موجز. قطر العين: WT الإقليم الشمالي مقابل WT ر P = 0.7219؛ bbs6 الإقليم الشمالي مقابل bbs6 ر P <0.0001؛ bbs9 الإقليم الشمالي مقابل bbs9 ر P <0.0001. منطقة كيس؛ bbs6 الإقليم الشمالي مقابل bbs6 ر P = 0.0407؛ bbs9 الإقليم الشمالي مقابل bbs9 ر؛ P = 0.0038. زاوية الجسم: WT الإقليم الشمالي مقابل WT ر P = 0.093؛ bbs6 الإقليم الشمالي مقابل bbs6 ر P = 0.0176؛ bbs9 الإقليم الشمالي مقابل bbs9 ر P = 0.038. ر، وتعامل. الإقليم الشمالي، لم يتم علاجها.

وقد تبين رودوبسين النبات إلى هدب لينظم إلى حد كبير من البروتينات استنادا Arf4، مثل ASAP1. استنزاف هذه البروتينات يقود الفشل إلى رودوبسين للوصول إلى هدب، الذي يرتبط الأكتين تراكم غنية في جميع أنحاء هدب المقبل لرودوبسين التعبير misslocalised (34). لذا رصدنا rho2 :: GFP الإيجابية في BBS morphants التالية Y27632 العلاج (35).فضلا عن الانتعاش من قطر العين، bbs6 أظهر morphants تعامل مع Y27632 الأرقام لم يزد من المستقبلات الضوئية، وفقا لتقييم رودوبسين التعبير، ولا سيما في الجزء البطني من شبكية العين (المواد التكميلية، الشكل S11).


وpathomechanisms دقيقة الكامنة ciliopathies تتطلب مزيدا من الوضوح. ومع ذلك، فإننا نعرف أن إشراك مسارات الإشارات الرئيسية المرتبطة هدب الأساسي، وتشمل القنفذ الإشارات (36، 37)، وغير متعارف عليه الخلية القطبية WNT / مستو (PCP) الطريق (9) وmechanotransduction من خلال إشارات الكالسيوم (38) بين الآخرين. ولذلك فإنه ليس من المستغرب تماما أن البروتينات هامة لتكون الأهداب قد يكون لها أيضا أدوار إضافية رئيسية في العمليات الخلوية مثل الانقسام السيتوبلازمي، الهجرة و / أو تنظيم الأكتين هيكل الخلية.
البيانات المقدمة هنا هي متسقة مع فرضيتنا السابقة التي زادت البلمرة أكتين، من خلال RhoA التقلبات، يعطل وظيفة طبيعية من أهداب الابتدائي ويكمن وراء التسبب في BBS وciliopathies ربما آخرين. ويدعم هذه الملاحظات مزيد من الدراسات الأخرى حيث meckelin (MKS3)، من خلال التفاعل مع Nesprin-2، وينظم أيضا الهيكل الخلوي الأكتين (39، 40)؛ فقدان وظيفة البروتين ciliopathy، TMEM216 يؤدي إلى معيبة تكون الأهداب والالتحام centrosomal، مع ما يصاحب ذلك من hyperactivation RhoA وDishevelled (41)؛ والخلايا RPGR ناقصة خفضت أعداد أهداب، أبطأ تقدم دورة الخلية، وضعف التعلق الركيزة وزيادة الاستقرار FA (16). وعلاوة على ذلك، فقد ثبت أن شكل الخلايا وانقباض تنظم تكون الأهداب (42).
يتم التعبير عن البروتينات BBS في القاعدية الهيئات، centrosomes وaxonemes أهداب ومجموعة فرعية تشكيل مجمع ظيفية البروتين (BBSome) المطلوبة لتكون الأهداب (7، 43، 44). والمثير للدهشة، لاحظنا في هذه الدراسة أن Bbs8 وBbs9، سواء مكونات BBSome يتم التعبير، على مقربة من اتفاقات الصيد، مما يشير إلى وظيفة جديدة لهذه البروتينات في هذا الموقع. وصلة وظيفية بين اتفاقات الصيد والتجمع الأكتين هو راسخة (إعادة النظر في (45))؛ ومع ذلك، فإن إعادة توزيع الملاحظة (مركزيا) فاس في BBS-نقص الخلايا المهاجرة يشير إلى دور أكثر المحلي للبروتينات BBS في اتفاقات الصيد ربما الاستقرار. وبالنظر إلى حقيقة أن استنزاف النتائج RPGR في أكثر FA النضج (16) والتي RPGR يتفاعل مع الاتجار حويصلة البروتين Rab8 (المشار حاليا منصب Rab8a)، كما يفعل أعضاء BBSome، وتصل إلى تكون الأهداب وتنظيم طول الأهداب قد يكون أكثر وضوحا مما كان يعتقد سابقا.
ربما لدينا النتيجة الأكثر لفتا هي زيادة كمية نشط RhoA وجدت في Bbs4، Bbs6 وBbs8 خلايا متحولة. RhoA هو ضروري لبناء الأكتين قمي الزمنية شبكة لرسو السفن الجسم القاعدية والخيط المحوري النمو. في دراسة قام بها عموم وآخرون. (46)، منعوا تشكيل شبكة الإنترنت القمي والالتحام الجسم القاعدية من قبل انقطاع الأكتين إعادة عرض وكانوا يعتمدون على تفعيل RhoA. هذا النموذج هو يتفق مع النتائج في هذه الدراسة الحالية ومع تقرير سابق لدينا على الهجرة الجسم الأساسية، وعيوب لرسو السفن وتنظيم أكتين المعيبة عند فقدان bbs8 والبروتين PCP، vangl2 (42). وهذا، بدوره، يربط إلى دليل على وجود جهاز الإشارات المشترك يقودها أشعث الذي يحكم كلا قمي لرسو السفن ومستو استقطاب الهيئات القاعدية (47).
وخلاصة القول، توضح هذه الدراسة أن البروتينات BBS تلعب دورا مركزيا في تنظيم الهيكل الخلوي الأكتين من خلال تغيير في مستويات RhoA وتشكيل فاس. وعلاوة على ذلك، ديسريغولاتيون من هذه العملية يؤدي إلى انخفاض تكون الأهداب وبالتالي مختلف الاضطرابات مسار الإشارات التي تدعم الظواهر ciliopathy نموذجية. ولعل المستوى النسبي لهذا الاضطراب يشير خلال تطوير حسابات للحصول على درجة عالية من التباين الملاحظ في المرضى المصابين داخل وبين العائلات على حد سواء. بل انه قد يذهب بعض طريقة لشرح الاختلاف الأليلي شائع بين متلازمات.
هناك حاجة لدراسات مستقبلية لفهم الآلية الدقيقة التي الأكتين التحلل يؤثر تكون الأهداب. ومن الجدير بالذكر أن BBS4، BBS8 وBBS9 عنصران من مجمع BBSome، اللازمة لتكون الأهداب (23) والتي BBS4 وBBS8 تعدل PCP (17، 32) توفير رابط مؤقت.

المواد والطرق

زراعة الخلايا

تم الحصول على خلايا متحولة الأولية من Bbs4 وBbs6 الكلى الفئران فارغة. وقد نمت الخلايا والحفاظ في DMEM-Glutamax، 10٪ مصل وP / S. في التجارب التجويع المصل، كانت تزرع الخلايا حتى جوعا confluency ثم المصل لمدة 24 ساعة. الإنسان Bbs4 وBbs6 تم استنساخ السلطات الوطنية المعينة التكميلية في pCMV-HA ويبني pCMV-MYC وtransfected التالية Effectene ترنسفكأيشن الكاشف (QIAGEN) تعليمات. Bbs8 كان -shRNA سابقا تصميم والتحقق من صحتها في (12) وتبع بروتوكول ترنسفكأيشن نفسه.


كانت مطلية خلايا الكلى الأولية غير متكدسة لمدة 12 ساعة في لوحات ستة جيدا قبل الحصول على الأفلام. وتم تشكيل لLSM 710 المجهر بمحركات مع الهدف × 63 حتى تأخذ إطار كل 10 دقيقة. تم استخدام البرمجيات Volocity (التايم، PERKINELMER) للسيطرة على المجهر وتحليل الأفلام.
للأفلام الأكتين مرور الزمن، كانت الخلايا غير المصنفة متموجة وtransfected في الزجاج 48-جيدا لوحات أسفل مع 10 ميكرولتر مع CellLight ™ أكتين-GFP * BacMam (إينفيتروجن). انتظرنا لمدة 48 ساعة، ومتحد البؤر Timelapse (متحد البؤر زايس 710 × 40 الهدف المياه) الصور أخذت كل 30 ثانية لمدة 1 ساعة.
للتجارب التئام الجروح وقد أخذت صور في بداية ونهاية التجربة. تم تحجيمها أربعة وثلاثون من هذه الصور وتم قياس السطح الفجوة استخدام برامج صورة J. وقد استخدم الفرق بين الأولى والنقطة الأخيرة أو مساحة تعافى من قبل الخلايا لأداء ر -test بين العينات.


كان المثقف خلايا coverslips على وغسلها مع الفوسفات مخزنة المالحة (PBS) قبل التثبيت. بعد غسلها 15 دقيقة في الخلايا الفورمالديهايد 3.7٪ في PBS مرتين. تم منع الخلايا مع 1٪ ألبومين المصل البقري في برنامج تلفزيوني لمدة 30 دقيقة وحضنت مع الأجسام المضادة الأولية المخفف في برنامج تلفزيوني بين عشية وضحاها في درجة حرارة الغرفة. تم غسلها الخلايا عدة مرات مع برنامج تلفزيوني والمحتضنة لمدة 1 ساعة مع الأجسام المضادة الثانوية الفلورية المناسبة (إينفيتروجن اليكسا فلور). تمت إضافة Phalloidin-رودامين لمدة 20 دقيقة قبل دابي نوى تلطيخ. وأثيرت الأجسام المضادة ضد BBS9 وBBS8 في أرنب باستخدام الببتيدات محددة؛ SPHPAKTGDGAQAEDC لBBS9 وGFLRPSTQSGRPGTME لBBS8 (كما نشرت سابقا في (44) الأجسام المضادة تم اختبار خصوصية لطخة الغربية في الأنسجة المختلفة، واستخراج الخلايا كانت تركيزات الأجسام المضادة المستخدمة لمناعي:. جاما تويولين (Abcam GTU88) 1/200، تويولين الأسيتيل (سيغما T6793) 1/500، GAPDH (Abcam 9485) طخة غربية 1/1000، Vinculin (سيغما) 1/50، ومكافحة Bbs8 1/100 لالمناعي و1/200 لطخة غربية، ومكافحة Bbs9 1/100 و 1/200 لطخة غربية. لمثبط حركة الخلايا D (سيغما) التجارب، 1 م م كانت ثابتة أضيف من مثبط حركة الخلايا D إلى الآبار لمدة 5 دقائق، وغسلها مع متوسطة جديدة وسمح لاستعادة ل5 و 15 و 20 دقيقة. الخلايا مع 3.7٪ الفورمالديهايد وملطخة phalloidin-رودامين للحصول على أهداب طول مثبط حركة الخلايا D التجربة (100 ن م) وأضيف لمدة 24 ساعة. الخلايا كانت ثابتة والملون مع تويولين الضد الأسيتيل.

التنسيق الكمي التصاقات وقياسات مستوى F / G

وقد تم الحصول على Vinculin FA الصور المناعي من خلايا مفردة غير متموجة باستخدام فلوري المجهر زايس Z1 IMAGER مع كاميرا AxioCam MRM والبرمجيات Axiovision. تمت معالجة كل صورة يدويا وجميع اتفاقات الصيد لكل خلية حساب. لحساب المسافة بين اتفاقات الصيد وغشاء الخلية، واستخدمت صورا لخلايا Vinculin الملون. قمنا بقياس المسافة بين الجزء الأكثر البعيدة كل FA وأقرب غشاء الخلية. لquantifications الأكتين F / G، وقد استخدم نفس الإعداد المجهر. تم تجهيز جميع العينات معا لتجنب التغيرات في شدة. تم تأمين التعرض إلى 100 مللي من أجل اتخاذ جميع عمليات الاستحواذ لجميع العينات باستخدام نفس التعرض. تم استخدام صورة J البرمجيات لقياس كثافة كل من القنوات باستخدام المجال الكامل من كل صورة. تم استخدام هذه الكثافة لحساب نسبة الأكتين F / G.

قياس ميكانيكا الخلية باستخدام تطلع micropipette

تم استخدام نظام الطموح micropipette بالتزامن مع متحد البؤر المسح بالليزر المجهر (SP2، لايكا، UK) إلى نضح فرد WT وBbs4 - / - الخلايا. وبالإضافة إلى ذلك تم إجراء المزيد من الدراسات باستخدام Bbs4 - / - الخلايا المعالجة مع المانع RhoA، Y27632. كان المثقف جميع الخلايا في أحادي الطبقة ومن ثم trypsinized واختبارها في تعليق. وشيدت على بال micropipettes من الزجاج الشعيرات الدموية (G-1، Narisinghe الدولية، المملكة المتحدة) وتكسرت إلى القطر الداخلي (على) من 6،5-7،5 ميكرون وظيفة جدار (φ) 2.1. تم تطبيق Sigmacote (سيغما، MO، الولايات المتحدة الأمريكية) لمنع التصاق الخلية إلى بال micropipettes. ويوضع تعليق خلية من 106 خلية / مل في غرفة مخصصة بنيت على مرحلة من مراحل المجهر المقلوب. وقد تم اختيار خلية فردية وضغط الفارغة من 1 سم H 2 O تطبيق لوضع الخلية في غيض من micropipette. ويستنشق الخلايا إلى أقصى الضغوط من 7 سم H 2 O بمعدل 5.48 سم H 2 O / ثانية. وسجلت الصور متحد البؤر GFPactin وما يقابلها من الصور brightfield كل 1.63 ق ل 180 ق باستخدام × 63 / 1،4 NA الهدف غمر النفط العائد الصور بحجم بكسل: 0.11 × 0.11 ملم. ويتكرر هذا الإجراء لمدة 10 خلايا من كل مجموعة. Bbs8 وBbs9 تم اختبار الأجسام المضادة خصوصية على الخلية لست] مختلفة البقع الغربية (التكميلي المواد، الشكل 8).
لكل خلية، وطول الطموح (L تم قياس) في micropipette من الصور brightfield وتآمر ضد الزمن. تم استخدام ماتلاب لتناسب التعبير التالي إلى البيانات استنادا إلى بولتزمان الصلبة الخطي قياسي (BSLS) نموذج اللزجة (48). ونتجت عن ذلك معامل التوازن الخلوي) التي تم استخدامها لتحديد صلابة من كل خلية.http://hmg.oxfordjournals.org/conten...-graphic-1.gifhttp://hmg.oxfordjournals.org/conten.../graphic-9.gif http://hmg.oxfordjournals.org/conten...graphic-10.gif

RhoA فحص

لتفعيل الفحص RhoA، استخدمنا RhoA G-LISA ™ عدة تفعيل الفحص (الهيكل الخلوي BK124) باستخدام مجموع استخراج البروتين من الخلايا متموجة وفقا لتعليمات الشركة الصانعة. في المقايسات تثبيط RhoA، تم علاج الخلايا مع تركيز 10 م م من Y27632 (سيغما) لمدة 30 دقيقة، وغسلها مع برنامج تلفزيوني وتجهيزها لالمناعي أو استخراج البروتين. للتجارب ترانسفيراز C3، 2 ميكروغرام / مل رو المانع I ADP ribosylation رو الأسباراجين-41 (الهيكل الخلوي، CT04) في المصل خالية المتوسطة. للتجارب الأكتين هيكل الخلية، تم إصلاح الخلايا بعد 5 ساعات، وللتجارب طول أهداب الخلايا كانت ثابتة بعد 3 ساعات. تم العثور على البيانات الخام من هذه التجارب في التكميلية المواد، الجدول.

morpholinos الزرد

تم حقن morpholinos الزرد في الأجنة خلايا مرحلة واحدة. تسلسل morpholino والتراكيز المستخدمة هي؛ bbs6 ATG 5'-GCTTCTTCTTACTAATGCGAGACAT-3؛ 4 نانوغرام / جنين، bbs9 ATG 5'-GGCCTTAAACAAAGACATCCTGTAG-3؛ 4 NGR / جنين.
لعلاج Y27632، وdechoroniated الأجنة المحقونة في 24 HPF وفصلها في الآبار بمحلول مكون من 100 نيوتن متر من Y27632. بعد 24 ساعة (48 HPF) تم غسلها مرتين مع المياه العذبة وسمح لتطوير لمدة يومين آخرين. لكانت ثابتة الأجنة تلطيخ phalloidin رودامين مع 4٪ PFA بين عشية وضحاها، وغسلها مع برنامج تلفزيوني / توين 20 بنسبة 0.05٪ وملطخة بين عشية وضحاها بمحلول مكون من phalloidin-رودامين. تم الأجنة التي شنت شقة في Cytofluor وتم الحصول عليها أكوام متحد البؤر. تم استخدام صورة J البرمجيات لقياس عرض وزاوية و somites. للتعبير رودوبسين، استخدمنا خط المعدلة وراثيا تيراغرام (rho2: EGFP) CU3 الزرد التعبير عن EGFP كما هو موضح سابقا (35).

رافت ابراهيم 11-23-2015 08:42 PM

الطفرات متخالف في bbs1، bbs2 وbbs6 لها تأثير روكبي المحتمل على المرضى بارديه-بيدل مع اثنين من الطفرات في موضع bbs الثاني

متلازمة بارديه-بيدل (BBS) هو اضطراب وراثي عديد المظاهر مع التباين المشترك بين وداخل الأسرة الكبير، الذي يعرض أيضا عدم التجانس الوراثي ملحوظا، مع سبعة تعيين مواضع BBS في الجينوم البشري. وقد أظهرت البيانات الأخيرة أن BBS قد تكون موروثة إما بسيط مندلية المتنحية أو سمة قليل الجينات، منذ الطفرات في اثنين مواضع مطلوبة في بعض الأحيان لالمرضية. وتشير هذه الملاحظة أن التفاعلات الوراثية بين BBS مواضع مختلفة قد تعدل النمط الظاهري، مما يسهم في تقلب السريري من BBS. نقدم ثلاث عائلات مع اثنين من الطفرات في أي BBS1 أو BBS2، والتي بعض وليس كل المرضى تحمل الطفرة الثالثة في BBS1، BBS2 أو BBS6 chaperonin المفترضة. في كل سبيل المثال، وجود ثلاثة أليل متحولة يرتبط النمط الظاهري أكثر شدة. واحدة من الأليلات مغلطة، علينا أن نظهر أيضا أن إدخال طفرة في خلايا الثدييات يسبب mislocalization مثيرة من البروتين مقارنة مع من النوع البري. وتشير هذه البيانات إلى أن الطفرات triallelic ليست دائما ضرورية لمظاهر المرض، ولكن قد تحفيز النمط الظاهري الذي يحدث من قبل اثنين من الطفرات المتنحية في أي مكان مستقل، وبالتالي إدخال طبقة إضافية من التعقيد على النمذجة الجيني للoligogenicity.

متلازمة بارديه-بيدل (BBS؛ OMIM 209900) هو اضطراب وراثي multisystemic تتميز التدريجي ضمور شبكية العين، polydactyly خلف المحور، والسمنة، والتشوهات الكلى والتعلم تأخير (1). وقد أثبتت الربط التقليدي والدراسات عزر البروتين سيليكون وعدم التجانس الوراثي كبير في BBS. وتم رسم لا يقل عن سبعة مواضع مستقلة في الجينوم البشري (BBS1 - BBS7)، خمسة منها تم استنساخ (BBS1، BBS2، BBS4، BBS6 وBBS7) (+2 - +12).
ترجمة المفاهيمية من هذه الجينات الخمسة BBS توفر بعض القرائن وظيفية، لأن أيا من هذه النصوص بترميز البروتين وظيفة معروفة (إعادة النظر في 13 - 15). ومع ذلك، فقد أشارت تحليلات طفرة وراثية أن وجهة النظر التاريخية التي BBS هو قد يكون اضطراب المتنحية مندلية التبسيط الشديد، منذ ذلك الحين، على الأقل في بعض الحالات، هناك حاجة إلى ثلاث طفرات على اثنين من BBS مواضع (الميراث triallelic) لإظهار المرض (16 - 18).
الأسس الجينية والجزيئية للسلوك قليل الجينات، ومن أمثلته BBS لكن الحالية أيضا في عدة اضطرابات وراثية أخرى، غير مفهومة (15، 19). في البداية، واقترح أن التباين الوراثي كبير في BBS قد تسهم في التباين المظهري العام (16). ومع ذلك، لم يدعم هذه الفرضية من خلال بيانات طفرة وراثية، حيث يمكن تمييزها عدم وجود فروق ذات دلالة إحصائية بين المظهرية المرضى إيواء الطفرات في مواضع مختلفة (+20 - 23). أثار اكتشاف الإرث triallelic، فيها بعض الأفراد المتضررين تأوي ثلاثة طفرات في اثنين مواضع، وهي إمكانية بديلة أن عدد الطفرات قد تعدل النتيجة السريرية. ومع ذلك، لم مقارنات المظهرية لأسر triallelic لا تظهر اختلافات جوهرية بين الأفراد أو الأسر التي لديها اثنان أو ثلاثة من الطفرات. في جميع الحالات الموثقة حتى الآن، كان مطلوبا من الطفرة الثالثة لتطوير BBS، وبدعم من وجود الأشقاء أعراض مع اثنين من الطفرات في مكان واحد (+16 - +18).
نحن تقديم أدلة وراثية والجزيئية التي تشير إلى أن بعض الطفرات BBS قد تمارس تأثير روكبي على النمط الظاهري BBS عن طريق تعديل بداية و/ أو شدة جوانب مختلفة من هذا الاضطراب. نفيدكم ثلاث عائلات مع اثنين من الطفرات في أي BBS1 أو BBS2، والذي تحور في جين الثالثة BBS الثاني موجودة في بعض، ولكن ليس كل المرضى وفي كل حالة يرتبط النمط الظاهري أكثر شدة. طبيعة والحفظ التطوري و، في حالة واحدة، وتقييم immunocytochemical من هذه الأليلات تشير إلى أن لديهم تأثير ضار على البروتين وليس من المرجح أن تكون الأشكال المحايدة. وبناء على هذه المعطيات، فإننا نقترح أن الأولي "تشغيل / إيقاف" نموذجا للtriallelism (17) قد تتطلب التعديل ونقترح أن الطفرات قليل الجينات قد تؤثر إما أو كل من انتفاذ والتعبيرية من النمط الظاهري BBS.


الفصل الغامض من الطفرات triallelic

كجزء من جهودنا لتأسيس النمط الجيني لجميع الجينات BBS المعروفة في لفيف متعددة الأعراق كبيرة، أجرينا تحليل تسلسل شامل عبر الإكسونات ترميز جميع الجينات BBS الخمسة المعروفة. خلال هذه الدراسات، حددنا ثلاث عائلات، AR768، PB009 وPB061 التي تفصل اثنين من الطفرات في أي BBS1 (AR768، PB009) أو BBS2 (PB061)، في نمط ثابت مع الميراث مقهورة. في AR768 الأسرة، حددنا اثنين المسببة للأمراض المرجح الترميز التعديلات تسلسل. الأول هو T إلى G تبدال في اكسون 12، والتي من خلال النتائج المفاهيمية الترجمة في تغيير مغلطة من ميثيونين إلى أرجينين في موقف 390 (M390R؛ الشكل 1 A). تم الإبلاغ عن هذا الخيار في السابق باسم تغيير الإمراض الأكثر شيوعا في BBS1، لأنه يمثل 18-32٪ من جميع الطفرات BBS1 (12، 16، 24). بالإضافة إلى ذلك، كما يحمل كل فرد من المتضررين ورثت أمومي 1 بي بي حذف (1650ΔC) في اكسون 16 من BBS1 الذي يسبب المفهوم، انزياح الإطار في ليسين 548 وتعطي إنهاء السابق لأوانه في كودون 579 (L548fsX579؛ الشكل 1 A). هذا التغيير عزلها مع المرض في هذه العائلة وغير موجود في 192 الكروموسومات السيطرة عرقيا يقابل. في الأسرة الثانية، PB009، وجدنا كل من sibs الثلاثة المتأثرة أن يكون متماثل لطفرة M390R المشتركة (الشكل 1 B). وأخيرا في الأسرة الثالثة، PB061، حددنا طفرة هراء متماثل R275X في BBS2 (الشكل 1 C) والتي كما ارتبط سابقا مع اضطراب (17).
الشكل 1. Triallelic الميراث في ثلاث عائلات BBS. (A) في AR768 الأسرة، وقد ورثت كل فرد يتأثر اثنين من التعديلات في BBS1: أ M390R متخالف (الأب) طفرة في اكسون 12 و 1 سنة مضت (الأمهات) الحذف في اكسون 16. الفرد أكثر تضررا، -04، يحمل الثالث (الأب) تغيير في BBS6، والثريونين للبرو الاستبدال في موقف 325 (T325P). (B) في PB009 الأسرة، جميع الأفراد المتضررين ثلاث -03، -04 -05 ويكون الطفرات M390R متماثل في BBS1. -03 و-04 قد ورثت طفرة L349W إضافية في BBS2 وتقديم النمط الظاهري الشبكية أكثر شدة. (C) نمط مماثل لتوزيع أليل في PB061 الأسرة؛ كلا -03 -04 وهي متماثل لهراء R275X BBS2 الطفرة، ولكن فقط في السيب أكثر تضررا -04 لديه تحور متخالف لصق تقاطع إضافية (IVS115 + 2T → C) في BBS1. وأكد طفرة BBS2 R275X من قبل BSL I الهضم، حيث لمن النوع البري الأليل، والمشقوق وamplicon 339 نقطة أساس إلى قسمين شظايا من 141 و 198 نقطة أساس، على التوالي، في حين أن الطفرة R275X ألغت موقع بي إس I.

وأشارت بيانات حديثة أن الطفرات BBS1 يقترن قد يكون كافيا للتسبب متلازمة بارديه-بيدل (12، 24)، على الرغم من أن التحليلات اللاحقة كشفت أن BBS1 تشارك أيضا في الميراث معقدة ولكن على تردد أقل من بعض الآخرين BBS مواضع معروفة (16). وكانت لدينا بيانات طفرية لكل عائلة تتفق مبدئيا مع الوراثة جسمية متنحية. ومع ذلك، فقد قدمت البيانات السابقة لدينا العديد من الأمثلة التي الطفرات المتنحية على ما يبدو هي في الواقع جزء من نمط الميراث معقد وفيه ثلاثة الأليلات الطافرة على اثنين من مواضع ضرورية لإمراض (+16 - +18، +25). وتمشيا مع هذه الملاحظة، وجدنا الأليلات المحرضة في موضع BBS الثاني في كل من العائلات الثلاث. ومع ذلك، في كل حالة، الطفرة الثالثة لم تعزل بين المصابين بهذا الاضطراب منذ واحد السيب المتضررة في كل أسرة قامت سوى اثنين BBS1 أو BBS2 الطفرات.
في قوقازي AR768 الأسرة، اكتشفنا تبدال 973 ألف → C في اكسون 3 من BBS6 التي كتبها ترجمة المفاهيم يؤدي إلى تغيير مغلطة غير متحفظ من ثريونين إلى البرولين (T325P). عواقب الهيكلية المحتملة لهذا التعديل والحفظ التطوري للثريونين (الشكل 3 تشير أ) أن هذا التحول هو على الارجح المسببة للأمراض. يتفق مع هذا التنبؤ، لم نجد هذا البديل في 192 الكروموسومات السيطرة عرقيا يقابل. هذا الأليل، ومع ذلك، لا تعزل بين المصابين بهذا الاضطراب. أنها تنتقل من الأب تتأثر (الذي هو بالتالي متغايرة مزدوجة لBBS1 وBBS6) واحد فقط من نسل المتضررين، -04؛ الأخوة المتضررين الآخرين، -03، يحمل البرية أليل نوع BBS6 (الشكل 1 A). على هذا النحو، وتغيير T325P لا يمكن أن يسبب النمط الظاهري.
الشكل 2. النمط الظاهري الشبكية من PB009. (A، B) العمر من ظهور اعتلال الشبكية وحدة الإبصار النسبية في PB009 الأسرة؛ ملاحظة الاختلافات بين sibs 'triallelic' -03 -04 ومع -05، الذي فقد اثنين من الطفرات BBS1 ولكن هو من النوع البري لBBS2. (C) توزيع التباين داخل الأسرة في عصر ظهور اعتلال الشبكية. تأسست سن بداية لكل فرد المتضررين في 10 عائلات مع اثنين أو أكثر تأثرا sibs تحمل واحدة على الأقل طفرة M390R في BBS1 وأي دليل على المتغيرات المسببة للأمراض في مواضع أخرى. على النقيض من ذلك إلى تباين متوسط ​​2.3 سنوات، لوحظ وجود تباين الحد الأقصى من 19 عاما في PB009 الأسرة.

الشكل 3. حفظ الطفرات مغلطة. (A) وثريونين يتم حفظها 325 موقف في كل orthologs BBS6 معروف؛ HS = الإنسان، BT = بقرة، آر = الفئران، مم = الماوس. BBS6 ليس التعرف عليها بسهولة في الكائنات الدنيا. (B) المحافظة على يسين في موقف 349 من BBS2. CF = الكلب، زز = الدجاج، د = ذبابة الفاكهة، AG = البعوض، قنفذ س = البحر، XL = القيطم، م = flatworm.Light الأزرق يدل على هوية الأحماض الأمينية. يصور الصفراء الأمينية تشابه حمض (بدائل الحفظ).

لاحظنا وجود نمط مماثل في الفصل قوقازي PB009 الأسرة، حيث بالإضافة إلى اثنين من الأليلات BBS1 M390R (واحد من كل من الوالدين)، sibs المتضررة -03 -04 ولقد ورثت تغيير L349W متخالف الأب في BBS2. ويمثل هذا الأليل إجراء تبديل غير متحفظ من بقايا الحفظ تطويريا (الشكل 3 B) لم يكن موجودا في 192 الكروموسومات السيطرة عرقيا المتطابقة، وبالتالي من المرجح أن تكون العدوى. ومع ذلك، فإن السيب الثالثة المتضررة، -05، لا ترث هذا البديل، وبالتالي يحمل على ما يبدو فقط الطفرات المتنحية BBS1 (الشكل 1 B).
وأخيرا، في PB061 الأسرة، فرد -04 ولكن ليس السيب المتضررة الأخرى -03 لديها طفرة الموروثة للأمهات في موقع لصق المانحة من اكسون 15 من BBS1 (IVS15 + 2T> C؛ الشكل 1 C). مثل الطفرة الثالثة في الأسرتين السابقة، وكان هذا البديل غير موجود في 192 الكروموسومات السيطرة عرقيا المتطابقة وربما له عواقب وخيمة على سلامة النص BBS1، لأن من المتوقع أن يسبب للقراءة من خلال إلى إنترون 15، وبلغت ذروتها في إنهاء السابق لأوانه كودون بعد 72 المخلفات.

أسر AR768، PB009 وPB061 تظهر التباين المظهري داخل الأسرة

أثارت بيانات دينا طفرة إمكانية أن أليل الثالث لوحظ في BBS1، BBS2 وBBS6 قد يكون لها تأثير تعديل على النمط الظاهري. افترضنا أن في كل أسرة المرضى الذين يعانون من الطفرات الثلاث قد يحمل النمط الظاهري أكثر حدة أو واسعة مقارنة مع sibs مع اثنين من الطفرات. لتحقيق ذلك، درسنا جميع البيانات السريرية المتاحة لكل مريض (الجداول 1 - ⇔ 3). لتجنب التحيز، تم إجراء هذا التحقيق من قبل RAL، PLB أو CC دون معرفة مسبقة من النمط الجيني.

الجدول 1.
الاختلافات المظهرية بين AR768-03 و-04. تم التأكد من كل فرد لكل من الجوانب الرئيسية والثانوية من النمط الظاهري BBS. وعلى الرغم من فحص كل أخ على مدى عدة سنوات، كلما أمكن ذلك تمت مقارنة النمط الظاهري في نفس العمر

الجدول 2.
ملخص الاختلافات المظهرية بين PB009-03، -04 و-05

الجدول 3.
الاختلافات المظهرية بين PB061-03 و-04

AR768 الأسرة.

AR768 العائلة هي عائلة غير الأقارب من أصول أوروبية الشمالية. ومع ذلك، على الرغم من أن كلا sibs الميزات الواضحة نموذجية من BBS، والمريض تقل ثلاثة الطفرات، -04، ويقدم شكلا أكثر حدة بكثير من BBS مقارنة مع شقيقتها الأكبر سنا (الجدول 1). وضعت AR768-03 عادة، وعلى الرغم من انخفاض حدة البصر، وقالت انها حافظت على درجات جيدة في المدرسة الابتدائية، لديه معدل الذكاء اختبار 110، لا يوجد لديه خطاب أو صعوبات في التعلم، وليس البدانة. وعلى النقيض من أختها، -04، وأصبح يعاني من السمنة في السنة الأولى من العمر، وكان نقص التوتر الملحوظ، ودفع غرامة اتناسق السيارات، وكانت دائما أكبر من لها قواعد العمر المتطابقة. انها طرحت لأول مرة كلمتين معا بعد سن 3 سنوات، وبنسبة 5.5 سنوات يمكن التحدث مع الخطاب الذي كان التأويل فقط من قبل والديها. لها IQ هو 92. على الرغم من أن لها معالم الحركية كانت طبيعية، استمر نقص التوتر المعتدل. في سن 5،5 كان لها محيط الرأس (54 سم)> المئوي 97th (والمئوي ال50 ليبلغ من العمر 14 عاما)، وكان ارتفاع لها 122.1 سم (> المئوي 97th، المئوي ال50 لالبالغ من العمر 7.5)، ولها وزن 37.4 كجم (> المئوي 97، والمئوي ال50 لالبالغ من العمر 11 عاما).

PB009 الأسرة.

PB009 الأسرة هو الأوروبية الأسرة الشمالية، غير الأقارب فيها جميع sibs تتأثر أيضا ميزات اضح من الكلاسيكية BBS، ولكن هناك ضرب أيضا الاختلافات المظهرية في الوزن، والنمط الظاهري في شبكية العين وبعض الجوانب السلوكية (الجدول الشكل 2 ألف وباء) . الأخوة الأول (PB009-03)، والآن 32 سنة، وأصبح قريبا من السمنة المفرطة بعد الفطام إلى الأطعمة الصلبة ولها مؤشر كتلة الجسم (BMI) هو الآن 33. وقد ظهرت عليها nyctalopia في سن 17، وقدم في وقت لاحق لأطباء العيون في 20 عاما مع " التهاب الشبكية الصباغي "، وحدة البصر من 6/12 وبراريق شفافة من القرص البصري الأيسر. حسب العمر 27 انخفضت حدة لها ل24/06 وأنها مسجلة الآن أعمى. الأخوة المقبل (PB009-04)، والآن 35 عاما، وأصبح أيضا يعانون من السمنة المفرطة في مرحلة الطفولة، ومثل أخته، له BMI تقف الآن عند 33. وضعت nyctalopia في سن 13 و 15 وكان رصيده حدة البصر 18/06. في ذلك الوقت تصبغ الشبكية متفرق مع وجود بقع Fuch لوحظت في تنظير القاع. لوحظت عيوب المجال كبيرة وأقراص شمعية شاحب في الفحص في سن 22. والتسجيل وكفيفة تم الانتهاء من 24 عاما. على النقيض من ذلك، شقيقة الأكبر (PB009-05)، والآن 37 عاما، هو أقل من زيادة الوزن من الأشقاء الثلاثة (BMI 29)، لم يقدم أي nyctalopia حتى أنها كانت 32 عاما وتم الكشف فقط العلامات المبكرة لاعتلال الشبكية عند 34 سنوات. وقالت انها لا تزال تتمتع بالقرب من حدة البصر مثالية بعد يوم.

PB061 الأسرة.

الأسرة الثالثة، PB061، هي عائلة غير الأقارب من المنطقة الجبلية في شمال إيطاليا. مثل العائلتين السابقة، سواء sibs يحمل BBS الكلاسيكية. ومع ذلك، أشار التقييم السريري مفصل فروق ذات دلالة إحصائية بين البلدين sibs المتضررة في التنمية وهيئة إدارة الوزن. تأخر التطور النفسي للPB061-03 أقل ما يقال ولكن ضمن المعدل الطبيعي: جلس في 9 أشهر، مشى في 15 شهرا، الكلمات الأولى تحدث في 12 شهرا، ولكن الجملتين الأولى لم تشكل حتى 3 سنوات. حاليا، وقالت انها نجحت بشكل جيد في المدرسة الثانوية مع دعم بسيط لضعف البصر. لها مؤشر كتلة الجسم هو 24.9 ولم تكن زيادة الوزن مشكلة كبيرة في أي مرحلة من مراحل حياتها. على النقيض من ذلك، PB061-02 (الذكور) من ذوي الخبرة تأخير كبير في مراحل تطور الطفل: جلس في 11 شهرا، وسار في 21 شهرا، الكلمات الأولى تحدث في عمر 2 سنة. ونظرا للصعوبات التعلم كبيرة، وتحتاج إلى دعم التعليم المستمر طوال سنوات الدراسة. وعلاوة على ذلك، شهدت PB061-03 زيادة الوزن على المدى الطويل منذ 3 سنوات من العمر؛ ويحتفظ له BMI الحالي بنجاح في 25، ولكن فقط مع نظام غذائي صارم.

النمط الظاهري في شبكية العين من طفرة BBS1 M390R

وتشير البيانات الطفرات والمظهرية لدينا أنه في كل عائلة الطفرة الثالثة تتزامن مع زيادة ملحوظة في شدة المرض من الميزات المظهرية محددة. ومع ذلك، فإن تقلب السريري موثقة في BBS (1، 13، 14، 21، 26، 27)، تشير إلى أن بعض هذه الاختلافات قد يكون راجعا إلى الأحداث العشوائية أو الأليلات في الآخرين، غير BBS مواضع. كنا تساءل عما إذا كان التباين ينظر في عائلاتنا نموذجية من BBS. ركزنا على النمط الظاهري الشبكية لسببين. أولا، واعتلال الشبكية هي السمة الأكثر ثابتة من BBS، وعلى النقيض من السمنة والتعلم / الظواهر السلوكية، الكمي لها هو أكثر موضوعية والتأثير البيئي وربما أقل وضوحا. ثانيا، والأسرة مع عرض النمط الظاهري الشبكية متميزة، PB009، هي M390R متماثل لBBS1. هذا الأليل هو الأكثر شيوعا طفرة BBS1 (12، 16، 24)، وتكفل لنا الفرصة لدراسة عدد كبير من المرضى الذين يعانون من واحدة أو متشابهة الأنماط الجينية. نحن مصممون على عمر البدء في 37 المرضى BBS من 23 عائلة الذين قاموا احد على الأقل طفرة M390R مع عدم وجود دليل على وجود طفرة ثالثة في مكان آخر. بما يتفق مع الدراسات الوبائية السابقة، وجدنا توزيع واسعة من ظهور اعتلال الشبكية، والتي تتراوح 1،5 حتي 23 عاما، على الرغم من أن متوسط ​​عمر ظهور في PB009 الأسرة كان غير نمطية لمتلازمة في 23 عاما، ويرجع ذلك أساسا إلى أواخر بشكل كبير سن بداية PB009-05 (34 عاما). نحن التحقيق بجانب الاختلاف في عمر البدء عن طريق اختيار جميع الأسر التي لديها BBS "المتنحية" واحد أو اثنين من الطفرات M390R في BBS1. في 10 عائلات المتاحة، كان فرق المتوسط ​​في سن بداية 2.3 سنوات مع انحراف معياري 1.7، في حين أنه في PB009 الأسرة كان الفارق في السن من بداية بقدر 19 عاما وخمسة الانحرافات المعيارية بعيدا عن أعلى قيمة (الشكل . 2C). والجدير بالذكر، كان الفارق في السن من بداية بين PB009-03 و-04 5 سنوات وضمن نطاق الاختلاف طبيعي. حتى عندما نحصر تحليلنا للأسر ذات التراكيب الوراثية BBS1 مماثلة لPB009 (أي M390R / M390R)، ما زلنا نلاحظ على خلاف قوي في متوسط ​​العمر من البداية. وعلى الرغم من أحجام عينة صغيرة، كنا قادرين على اختبار الفرضية القائلة بأن وسائل هاتين المجموعتين من المرضى متطابقة باستخدام heteroscedastic (الفروق غير متكافئة) الذيل اثنين ر -test، وحصل على -value P 0.052، وتوفير موحية الإحصائية دليل. عندما اختبرنا ما إذا كان المعارض PB009 زيادة كبيرة التباين في سن بداية مع F -test (F = 16.0؛ 2 و 5 مدافع)، ونحن أيضا الحصول على دليل إحصائي قوي نسبيا لمثل هذا التباين زيادة (P <0.014). الفرق في التباين المظهري أصبح كبيرا للغاية عندما تم إدراج جميع الأسر BBS1 المتنحية مع واحد طفرة M390R (P <0.05).

النمط الظاهري الخلوية من البديل BBS6 T325P

وعلى الرغم من ارتباط محتمل بين شدة السريرية وعدد الأليلات الطافرة في كل من ثلاث اسر، فضلا عن الطبيعة غير متحفظة من الطفرات مغلطة وغيابهم عن الصبغيات السيطرة عرقيا المتطابقة، تبقى إمكانية الرسمية التي L349W BBS2 والأليلات T325P BBS6 هي الأشكال حميدة. لطفرة BBS2، ونقص المعلومات عن البروتين يمنع حاليا تقييم وظيفي لها. على النقيض من ذلك، إنشاء توزيع الخلوية من النوع البري البروتين BBS6 (JCK وMRL والملاحظات غير منشورة) مكننا لفحص أي عيوب التعريب المحتملة في BBS6 التي تسببها طفرات BBS6.
BBS6 هو جين أعرب على نطاق واسع الذي يظهر التماثل إلى النوع الثاني chaperonins (ترجمة المفاهيمي 28). قد تورطت هذه أسطواني، المحرمين الجزيئية التي تعتمد على ATP في للطي من مجموعة واسعة من البروتينات الخلوية (29) ومرافقين وقد شاركت في العديد من الاضطرابات الإنسان (30). ومع ذلك، لا تزال هناك كل من أهمية وظيفية من هذا التشابه ودور الخلوية من البروتين BBS6 جهود إحباط غير محددة، وبالتالي لفحص إمكانية المسببة للأمراض من BBS6 متغيرات تسلسل.
عند النظر في التأثير المحتمل للأليل T325P على BBS6، ونحن افترضنا أن طبيعة التغيير قد يؤثر على بنية و / أو قدرة البروتين لأضعاف بشكل صحيح، والتي قد تؤدي بدورها إلى أي تدهور أو mislocalization من متحولة BBS6. لتقييم هذا الاحتمال، ونحن transfected خلايا هيلا مع يبني البلازميد التي تعبر عن MYC الموسومة البرية من نوع (وزن) BBS6 أو Myc على الموسومة T325P متحولة BBS6. وأظهر تحليل لطخة الغربي من الخلايا المصابة بالعدوى بالنقل التي يتم إنتاجها كل من البروتينات عند مستويات مماثلة وتظهر الحجم المتوقع من ~60 كيلو دالتون (الشكل 4 A). وتشير هذه الملاحظات أن البروتين BBS6 متحولة ليست معرضة بشكل خاص للتدهور. ثم تم تحديد أنماط توطين الخلوية من Myc على-BBS6 (بالوزن) وMyc على-BBS6 (T325P) البروتينات التي مناعية على خلايا هيلا مع الأجسام المضادة الأولية محددة ل13 الأحماض الأمينية Myc على العلامة والأجسام المضادة الثانوية إلى جانب وجود صبغة الفلورسنت الأخضر .
الرقم 4. mislocalization الخلوي من BBS6 (T325P) متحولة البروتين. (A) تحليل لطخة غربية من خلايا هيلا التي كانت إما untransfected، أو مع transfected Myc على-BBS6 البرية من نوع (بالوزن) أو Myc على-BBS6 (T325P) بنيات متحولة باستخدام حيدة النسيلة الأجسام المضادة لمكافحة Myc على. (B) سيتولوجية مناعية الخلايا معربا عن Myc على-BBS6 (بالوزن) أو MYC-BBS6 (T325P) يبني يستخدمون مضاد للMyc على وحيدة النسيلة الأولية الضد والضد الثانوية بالإضافة إلى فلور اليكسا 488 الصبغة. إشارات MYC-BBS6 خضراء، وملطخة النوى مع دابي (الأزرق). خلايا Untransfected عرض فقط تلطيخ دابي بارز (أي تلطيخ الأخضر)، كما يمكن أن يرى في بعض الخلايا الموجودة في الفريقين.

وأظهرت إشارات المناعي من البروتين Myc على-BBS6 (بالوزن) نمط تلطيخ عصاري خلوي مميز التي امتدت الخروج من النواة (الملون الأزرق مع دابي) وأصبح الخيطية ملحوظ بالقرب من محيط الخلية (الشكل 4 B، اللوحة العلوية). هذا النمط التعريب لا يمكن تمييزه عن أن من النوع البري BBS6 يخلو من علامة، ويختلف اختلافا كبيرا عن تلك التي chaperonin عصاري خلوي ترتبط ارتباطا وثيقا، CCT (مخطوطة قيد الإعداد). في المقابل، أظهرت جميع الخلايا معربا عن Myc على-BBS6 (T325P) البروتين نمط توطين مختلف جذريا (الشكل 4 B، اللوحة السفلية). وكانت خيوط BBS6 لم يعد تمييز، والأكثر من البروتين يبدو لتشكيل كتل أو مجاميع في المواقف المختلفة في السيتوبلازم في جميع الخلايا التي تم فحصها.


BBS هو اضطراب عديد المظاهر من التعقيد السريري والجزيئي كبير. وقد كشفت عمليات التقييم المشترك بين المظهرية واسعة والتباين داخل الأسرة (1، 21 - +23، 26، 27، 31). وكانت محاولات ربط الأنماط الجينية مع النمط الظاهري على أساس مكان التجانس غير حاسم، وكذلك الدراسات التي أخذت بعين الاعتبار وجود طفرات triallelic، مما يشير إلى نمط أكثر تعقيدا من التشكيل المظهري (17، 18).
لقد ذكرت هنا ثلاث عائلات فيها بعض، ولكن ليس كل شيء، فقد ورثت المرضى الثلاثة طفرات في اثنين من الجينات BBS. هذا النمط من الميراث لطفرة ثالثة غير متوافق مع السببية والتيار "تشغيل / إيقاف" نموذج triallelism. لذلك فإننا في ثلاثة بدائل ممكنة ويستبعد بعضها بعضا: (ط) أن أليل الثالث الكشف في كل من العائلتين هو تعدد الأشكال حميدة. (ب) أن أليل الثالث هو الإمراض ولكن الحاضر مصادفة في هؤلاء المرضى. أو (ج) أن أليل الثالث لا السببية في هذه الأسر ولكن يمارس تأثيرا المعدلة.
لا يمكن استبعاد الاحتمال الأول، لكننا نقترح أنه من غير المرجح على أساس ثلاثة أسطر من الأدلة. أولا، كل الطفرة إجراء تبديل غير المحافظين الذي يتوقع أن يكون لها تأثير كبير على البروتين: التغيير L349W BBS2 محل بقايا دهنية الحفظ جدا مع حلقة عطرية، يمكن أن تؤثر على الذوبان، ومن المتوقع أليل T325P BBS6 لإدراج شبك في البروتين، وبالتالي تغيير هيكلها ثلاثي الأبعاد وطفرة لصق في BBS1 يدخل وقف كودون المبكرة ويلغي BBS1 مرنا من الاضمحلال بوساطة هراء ربما. ثانيا، لم تكن أي من هذه التغييرات الحالي في 192 الكروموسومات السيطرة عرقيا المتطابقة وتشمل كلا التعديلات بقايا الحفظ جدا (الشكل 3). وأخيرا، على الرغم من أن النمط الظاهري الخلوية من L349W لا يمكن التأكد نظرا لتوزيع الخلوية غامضة من النوع البري BBS2، عندما قدمنا ​​البروتين BBS6 معربا عن البديل البرولين 325 في خلايا الثدييات، لاحظنا النمط الظاهري الخلوية المضربين، حيث يفقد البروتين القدرة على توطين بشكل صحيح في الخلية، وبدلا من تشكل الحصى واضحة في السيتوبلازم. هذا ومن المرجح أن تكون ضارة إلى وظيفة عادية.
وبالنظر إلى أن BBS6 T325P، BBS2 L349W وBBS1 لصق المتغيرات تقاطع ربما تضر البروتين، يصبح السؤال ما إذا كانت هذه غير فصل-المتغيرات المسببة للأمراض في جين BBS تؤثر على النمط الظاهري الناجمة عن اثنين من الطفرات في موضع آخر BBS. أن المرضى ذكرت يحملون قبيل الصدفة من BBS1، BBS2 أو BBS6 طفرة على التوالي هو المرجح، بالنظر إلى أن الطفرات يقترن في كل من BBS1، BBS2 وBBS6 وقد ثبت أن يسبب BBS (4، 10، 12، 16، 24) والمشاركة في الميراث triallelic (16 - 18، 25). وعلاوة على ذلك، لقد أظهرنا سابقا أن انخفاض معدل BBS في القوقازيين (1: 100 000-1: 160 000) إلى جانب مساهمة صغيرة نسبيا من BBS2 وBBS6 الطفرات إلى متلازمة (18 و 6٪ على التوالي) تجعل إمكانية هؤلاء الأفراد يجري ناقلات محاسن تذكر (17). حتى لBBS1، موضع BBS الأكثر شيوعا في القوقازيين، وفرصة للشركات محاسن صغيرة (1: 380-1: 430 استنادا إلى مجموعة من التردد المرض بين 1: 100 000-1: 125 000). الأهم من ذلك، في حدود قدرتنا على قياس النمط الظاهري بدقة، والتباين داخل الأسرة الملحوظ الذي يحتمل الناجمة عن طفرة ثالثة أكبر بكثير من التباين داخل الأسرة في BBS بشكل عام. وبطبيعة الحال، لا يمكن تحديد مساهمة دقيقة من أليل الثالث في موضع الثاني إلى النمط الظاهري على وجه اليقين. فمن المحتمل أن بعض الاختلاف الملاحظ في التعبيرية هي نتاج ما تبقى من الجينوم، وكذلك البيئة. ومع ذلك، فإنه من غير المرجح أن في كل أسرة في فوج لدينا، العلاقة بين وجود طفرة الثالثة والنمط الظاهري أكثر حدة هو من قبيل الصدفة، على الرغم من أن يطلب من الأسر إضافية لفهم وترسيم تأثير الدقيق لمثل هذه الأليلات.
بناء على ملاحظاتنا، نقترح نموذجا حيث مثل هذه الأليلات غير فصل BBS تمارس تأثير التعديل على النمط الظاهري هو التفسير الأكثر قبولا البيانات المتوفرة لدينا. في الخلفية الوراثية توعية بالفعل، يمكن أن الطفرات إضافية في أي مكان BBS مستقلة تساهم في تقلب داخل الأسرة كبيرا لاحظ ينظر في BBS. على سبيل المثال، في PB009 الأسرة، كل من sibs الثلاثة المتأثرة يظهر BBS. ومع ذلك، فإن sibs اثنين مع ثلاثة تحولات لديها النمط الظاهري في شبكية العين بشكل ملحوظ أكثر شدة مع fundi معرض نموذجي "التهاب الشبكية الصباغي" علم الأمراض، في حين أن البكر السيب الثالث سوى تغيرات طفيفة قاعية في 37 سنة من العمر. مقارنات بين حدة البصر من sibs ثلاثة تتفق أيضا مع هذا الاختلاف، لأن كلا PB009-03 و-04 المكفوفين من الناحية القانونية، في حين -05 لديها الرؤية العادية. الأهم من ذلك أن الاختلاف في بداية اعتلال الشبكية في تلك العائلة هو أكبر بكثير من الاختلاف الملاحظ في 10 عائلات أخرى مع الطفرات المتنحية BBS1 على ما يبدو، واحدة منها على الأقل غير M390R.
وبناء على هذه الملاحظات، فإننا نقترح أن طبقة إضافية من التعقيد قد تكون موجودة في علم الوراثة من BBS. فرضية triallelic الأولية فيها ثلاثة الطفرات اللازمة لالمرضية قد تبسيط مساهمة حقيقية من كل مكان إلى النمط الظاهري. في حدود الدراسة ثلاثة الأسرة الحالية، نتائجنا تتسق مع فكرة أن الطفرات غير المندلية في أحد BBS مكان يمكن أن تسهم في تعديل النمط الظاهري BBS التي تسببها طفرات في مكان آخر. على هذا النحو، triallelism "نقية"، التي الأفراد مع اثنين من الطفرات في مكان واحد بدون أعراض ولكن الأفراد مع ثلاثة تحولات تتأثر، وتحديد واحدة من نهاية الطيف التي أليل متحولة في واحدة BBS مكان يمكن أن يكون لها تأثيرات متغيرة أو حتى المتطرفة على التعبيرية من الطفرات يقترن في موضع آخر (الشكل 5).
الرقم 5. المفاهيمي (المثالية) تمثيل تأثير الأليلات الطافرة على النمط الظاهري. ضمن مجموعة من السكان المريض، واثنين من الطفرات في مكان واحد يؤدي إلى مجموعة من الظواهر، من غير متناظرة / الإكلينيكي لBBS الشديد. إدخال أليل السببية الثالث (الخط المنقط الأزرق) يقلل أو يلغي عددا من الأفراد غير متناظرة ولكنها لا تؤثر في توزيع شدة الشامل للاضطراب. على النقيض من ذلك، وإدخال طفرة المعدلة (أحمر متقطع سطر) يزيد من شدة الشاملة للاضطراب وقد يسبب أيضا بعض الأفراد الذين لولا ذلك أعراض لإظهار شكل خفيف من المرض.

و"التدرج" النموذج أعلاه لتفاعلات الطفرات triallelic يتفق مع ملاحظة أن من بين الأسر BBS triallelic الإبلاغ عنها حتى الآن (17، 18)، وهناك المزيد من المرضى مع ثلاثة تحولات في اثنين مواضع من الأفراد تتأثر مع اثنين من الطفرات في واحد مكان. على الرغم من أن لدينا أي سبب للشك في أن يعود هذا التوزيع إلى أي تحيز واعية من التثبت أو التعيين (باستثناء تلك التي تتأثر السريرية)، والتفسير الأكثر قبولا هو أن ليس كل الطفرات triallelic ضرورية لالمرضية. بدلا من ذلك، قد تؤدي إلى تفاقم بعض جوانب النمط الظاهري.
وتوضيح الأثر النسبي لكل طفرة في كل مكان على أي جانب من جوانب النمط الظاهري BBS تكون صعبة، لأن: (ط) لحساب مواضع معين فقط حوالي 40٪ من جميع الأسر BBS، مشيرا إلى أن العديد من أكثر BBS مواضع تبقى uncloned. (ب) لا يتم التعرف على العديد من العوامل التي تنظم النمط الظاهري بعد؛ و (ج) غير مفهومة حتى الآن العلاقات بين والتفاعلات بين مكونات جينية معروفة من هذا الاضطراب. وهكذا، فإن كلا من تحديد الجينات المسببة إضافية BBS ودراسات النمط الظاهري النمط الجيني مفصلة عن أعداد الكبيرة ستكون حاسمة بالنسبة لنموذج الآلية الجزيئية (ق) من oligogenicity، وهو نوع من انتقال سمة ذات الصلة لفهم كلا مندلية والصفات البشرية المعقدة.

المواد والأساليب

أسر بارديه-بيدل

تم التحقق من الأفراد مع BBS وفقا لمعايير محددة سلفا (1). في جميع الحالات، وأجريت مقابلات مفصلة من قبل محقق من ذوي الخبرة (RAL، CC أو PLB)؛ وطلب من جميع السجلات الطبية المتاحة ومراجعتها للتأكد من معايير التشخيص. تم فحص جميع أفراد المتضررين من كل عائلة من قبل الفاحص واحد (RAL، CC أو PLB)، الذي كان يرتدي قناعا على البيانات الوراثية. تمت الموافقة على هذه الدراسات من قبل مجلس المراجعة المؤسسية للبحوث موضوع الإنسان في كلية بايلور للطب ولجنة استعراض أخلاقيات معهد صحة الطفل، جامعة كلية لندن.

فحص التحور

تم استخراج الدم والحمض النووي أعدت من الخلايا الليمفاوية وفقا للأساليب المنشورة (16). وتضخمت بكل exons من كل جين BBS وشملت كل amplicon كل من اكسون وكذلك تقاطعات لصق intronic كما هو موضح (4). وتنقيته المنتجات PCR تضخيمها من الحمض النووي للمرضى وأقاربهم مع عدة تنظيف إكسو-SAP (USB) والتسلسل مع صبغ التمهيدي أو صبغ فاصل الكيمياء على ABI 377 (النظم البيولوجية التطبيقية) أو MegaBACE 1000 (أمرشام العلوم البيولوجية) المنظم الآلي . وتمت مواءمة سلاسل الناتجة عنها، وتحليلها مع برنامج محاذاة تسلسل Sequencher (رموز الجينات). لPB061، بالإضافة إلى التسلسل، تقييد خلاصة BBS2 أجريت اكسون 8 من أصل. طفرة R275X تلغي لبي إس I موقع 141 نقطة أساس في جزء 339 سنة مضت.

إعداد بنيات

الترميز المنطقة بأسرها من البشر BBS6 تم تضخيم [كدنا بواسطة تفاعل البلمرة المتسلسل (PCR) مع 'التمهيدي تحتوي على 5 سال موقع I (GTCGACCATGTCTCGTTTGGAAGCTAAG) و3' التمهيدي ايواء ليس موقع I (GCGGCCGCTTAGTTTTTATCTTCAATAAC). تم استيعاب المنتج مع سال الأول وليس أنا، وsubcloned إلى pCMV. Myc على ناقلات (BD العلوم البيولوجية). تم إنشاء نقطة متحولة T325P BBS6 مع موقع السريعة التغير عدة الطفرات الموجهة (Stratagene). تم التحقق من كل من يبني بواسطة التسلسل مزدوج الجديلة.

لطخة غربية وتحليل المناعية

كانت خلايا هيلا مثقف في 18 ملم coverslips إلى 80٪ confluency وعابر. مع Myc على الموسومة من النوع البري أو T325P BBS6 متحولة ناقلات التعبير مع Polyfect ترنسفكأيشن الكاشف (QIAGEN). بعد ستة عشر ساعة ترنسفكأيشن، كانت ثابتة الخلايا في -20 درجة مئوية الميثانول، permeablized في 0.1٪ تريتون X-100، ومنعت بمحلول ملحي تريس مخزنة (TBS) تحتوي على 5.5٪ مصل الماعز. وحضنت الخلايا مع مكافحة Myc على الماوس وحيدة النسيلة الأجسام المضادة (Clontech)، وغسلها في TBS، ثم حضنت مع الأجسام المضادة الثانوية مترافق لاليكسا فلور 488 صبغ (المسابر الجزيئية). كانت ملطخة الخلايا مع دابي والتي شنت في إطالة Antifade كاشف (المسابر الجزيئية)، للمراقبة تحت المجهر أوليمبوس Vanox AHBS3. تم تجهيز الصور التي تم التقاطها باستخدام برنامج أدوبي فوتوشوب.

رافت ابراهيم 11-23-2015 08:46 PM

النمط الظاهري السلوكي لمتلازمة بارديه-بيدل

متلازمة بارديه-بيدل (BBS)، المعروف أيضا باسم متلازمة لورنس-مون بارديه-بيدل (LMBBS)، منذ فترة طويلة اعتباره شرطا مقهورة ولكن الأدلة الحديثة تشير الآن إلى نمط أكثر تعقيدا من الميراث. 1- 3 معدلات الانتشار مجموعة من 1 في 100 000-1 160 في 000، 4- 6. على الرغم من أن هناك المجتمعات التي BBS يبدو أن أكثر شيوعا نتيجة لزواج الأقارب 7 BBS هو حالة وراثية غير متجانسة مع مواضع ستة جين معين إلى تاريخ: 11q13 (BBS1)، 8 16q21 (BBS2)، 9 3p12-13 (BBS3)، 10 15q23 (BBS4)، 11 2q31 (BBS5)، 12 و20p12 (BBS6 / MKKS). 13، 14 ثلاثة من هذه الجينات قد تم الآن التي تم تحديدها، BBS2، BBS4، وBBS6. 15 والنمط الظاهري من BBS يختلف من أسرة إلى أخرى وداخل الأسر، مع اختلاف فقط المظهرية خفية تتعلق جينات مختلفة تم تحديدها حتى الآن. 16، 17
وتشمل المعايير الرئيسية المقبولة لتشخيص ضمور شبكية العين، والسمنة، polydactyly، قصور الغدد التناسلية الذكور، والتخلف العقلي، والفشل الكلوي. 3 بالإضافة إلى الميزات الرئيسية، وعدد من الميزات الثانوية المرتبطة بها، بما في ذلك عصبية، والكلام، والعجز اللغوي، والصفات السلوكية ، وقد تم تحديد خلل البنية؛ شوهة الوجه، وشذوذ الأسنان. 18 وتشمل المشاكل السيارات التي تم تحديدها التأخر في اكتساب المهارات الحركية، مشية غير مستقرة، وترنح. 18 تأخر تطور اللغة في كثير من الحالات، على الرغم من أن هذا قد يكون يتناسب مع وظيفة الفكرية الشاملة، و هناك أيضا تقارير عن مشاكل في الكلام والتي تشمل صعوبات النطق وإغفال ساكن أو التشوهات، والتلفظ خنة مفرطة. 17- 19 وقد وصفت تأخر في النمو على نطاق واسع باعتباره سمة رئيسية من سمات BBS، مع الثلثين لثلاثة أرباع المرضى أداء في مجموعة التخلف العقلي على اختبار رسمي 18، 20 (ولكن انظر الخضراء وآخرون 3 لاستثناء).
تم الإبلاغ عن اضطرابات في السلوك في بعض المرضى BBS. وتشمل السمات ذكرت عدم النضج العاطفي، ونوبات متكررة المتقلبة، السلوك غير اللائق والجرأة وعدم القدرة على التعرف على الاشارات الاجتماعية، وسطحية تؤثر. 18 وورد أن بعض المواد لإظهار الهوس / الميول القهري وتفضيل روتين ثابت. وقد أبلغ كل من غفلة وسهلة الانقياد، والاهتمام الذي لا يتزعزع. 18 ولكن، حتى الآن درسوا توجد دراسات منهجية النمط الظاهري السلوكي للمرضى الذين يعانون من BBS.
هناك اعتراف متزايد بأن الاضطرابات الوراثية قد يكون لها آثار معينة على السلوك. 21- 24 السلوكيات التي هي مشتركة ومحددة لاضطراب وراثي يفترض أن تشترك في الأصل الجيني الكامن وتم وصف الظواهر السلوكية. ومن المسلم به عموما أن مثل هذا السلوك لا فريدة من نوعها (ولا عالمي بالضرورة) لكل متلازمة وراثية بل أن هناك احتمال متزايد أو احتمال أن يخضع مع متلازمة سوف تظهر سلوك معين. 21، 25 وقد تم إحراز تقدم الأخيرة في توضيح من النمط الظاهري السلوكية العديد من المتلازمات الوراثية، بما في ذلك متلازمة ريت، 26، 27 متلازمة سميث Lemli-Optiz، 28 ومتلازمة FG. 29 والاعتراف الظواهر السلوكية في المتلازمات الوراثية مهم في مساعدة اعتراف سابق والتشخيص. قد يكون هذا أهمية خاصة في متلازمة مثل BBS حيث يعني معقد، وعرض متعدد الأوجه التشخيص غالبا ما يتم تأخير كبير. 18 الاعتراف الظواهر السلوكية المهم أيضا بالنسبة للإدارة الطبية والتعليمية، ويساعد في فهم الوالدين ل، والتكيف لوطفلهما.
النقاط الرئيسية

  • على الرغم من الخصائص السلوكية، بما في ذلك السلوك الجرأة وعدم القدرة على التعرف على الاشارات الاجتماعية، والميول الوسواس القهري و، وقد لوحظ في المرضى الذين يعانون من متلازمة بارديه-بيدل (BBS)، حتى الآن درسوا توجد دراسات منهجية النمط الظاهري السلوكية.
  • الانتهاء من الآباء والأمهات من 21 طفلا مع BBS ينظر لإجراء تقييم سريري متعدد التخصصات تدابير موحدة للسلوك.
  • الأطفال الذين يعانون من BBS أظهرت زيادة مستويات internalising المشاكل بما في ذلك الشعور سحب والقلق / الاكتئاب. لديهم أيضا ارتفاع مستويات الاجتماعي، والفكر، ومشاكل الانتباه. سجل أقلية كبيرة في مجموعة السريرية على مقياس من أعراض التوحد، رغم أن لا شيء تحقق معايير التشخيص السريري. وكان الأطفال أيضا ارتفعت درجات على مقياس السلوك المتكرر وذكرت الأغلبية أن يكون الهوس من قبل والديهم.
  • وأشارت هذه النتائج الحاجة السريرية الكبيرة التي كانت تتم تلبيتها في كثير من الأسر. أسئلة للبحث في المستقبل تشمل ما إذا كانت التغييرات السلوك مع التقدم في السن أو يختلف وفقا لطفرة جينية.

هذه الورقة هي أول محاولة لوصف منهجية النمط الظاهري السلوكي لسلسلة من الأطفال الذين يعانون من BBS باستخدام التدابير السلوكية القياسية.


كان ينظر إلى الأطفال في العيادة تقييم neurodisability في مستشفى جريت أورموند ستريت للأطفال NHS الثقة، لندن، المملكة المتحدة. تم الحصول على الموافقة الأخلاقية من لجنة مشتركة بحوث أخلاقيات مستشفى جريت أورموند ستريت للأطفال NHS الثقة ومعهد صحة الطفل.
تصميم والمشاركين

وقد تم تحديد اثنين وخمسين الأطفال مع تشخيص BBS من خلال مجموعة الدعم الأسري LMBBS وقسم علم الوراثة السريرية في مستشفى غاي في لندن، المملكة المتحدة. دعي أولياء أمور جميع الأطفال للانضمام إلى دراسة و26 وافقوا على المشاركة (50٪). شوهد واحد وعشرين طفلا (11 من الذكور و 10 من الإناث) ضمن الإطار الزمني للدراسة (40٪). لم تكن هناك بيانات متاحة لاختبار مدى تمثيل العينة ينظر مقارنة مع عينة دعوة للمشاركة. كان هناك خمسة أزواج السيب (10 طفلا) في مجموعة الدراسة. لم يكن أي من الأطفال في هذه الدراسة من زواج الأقارب. في تقييم كان الأطفال بين سن 3 سنوات 7 أشهر و 18 سنة 0 أشهر (يعني 9 سنوات 11 شهرا، SD 51 شهرا). في جميع المواد الدراسية وأكد تشخيص BBS من خلال تطبيق معايير التشخيص 18 بعد أن أحيلت مع تشخيص مبدئي من قبل طبيب الأطفال المحليين.

معدل الذكاء

أكملت تسعة عشر الأطفال مقياسا موحدا للاستخبارات (IQ)، ومقياس الذكاء وكسلر للأطفال (WISC-III-UK)، 30 أو كسلر مرحلة ما قبل المدرسة ومقياس أساسي للاستخبارات (WPPSI-R-UK)، 31 اعتمادا على عمر الطفل. كانت تدار نسخة شكل قصيرة من كل اختبار وكانت واسعة النطاق، اللفظي، ودرجات معدل الذكاء الأداء المؤيدة للتصنيف. سارت على الشكل شكل القصير الذي أوصت به كوفمان وآخرون 32 وشملت أوجه التشابه والحساب الاختبارات اللفظية والصورة إنجاز وكتلة تصميم اختبارات الأداء. وكان غير قادر على إكمال تقييم رسمي أصغر طفل. حاول ثلاثة أطفال آخرين فقط الاختبارات الفرعية اللفظية بسبب ضعف حدة البصر.
التدابير السلوكية

والدي كل طفل 21 الانتهاء من آخينباخ سلوك الطفل المرجعية (CBCL). 33 هذا التحقق جيدا التدابير على نطاق ومجموعة من خارجيا (على سبيل المثال، مشاكل الانتباه والعدوان) وinternalising (على سبيل المثال، والقلق، والاجتماعي، وجسدية) المشكلات السلوكية. يتم التعبير عن عشرات الموحد الى عشرات T (متوسط ​​عدد السكان 50، SD 10). يوفر مقياس العرضية قطع للحدود (> 67) ومستويات السريرية (> 70) من الاضطراب السلوكي.
الانتهاء من الآباء والأمهات أيضا الروتينات الطفولة الجرد (CRI). 34 هذه التدابير على نطاق والطقوس، التكرار، والقهري مثل السلوكيات. تتوفر فقط البيانات المعيارية على الأطفال النامية عادة حتى سن 72 شهرا. ومع ذلك، بيانات غير منشورة من عينة كبيرة من الأطفال الذين تتراوح أعمارهم بين 5-18 عاما يعانون من متلازمة برادر ويلي (ن = 75) والتوحد في مرحلة الطفولة (ن = 90) توفير البيانات المقارنة المناسبة على الأطفال من نفس العمر ومعدل الذكاء لعينة BBS.
الانتهاء اثني عشر أولياء الأمور أيضا الطفولة التوحد مقياس تصنيف (CARS). 35 هذه التدابير على نطاق والاجتماعية، والاتصالات، وضعف المتكررة المميزة من الأطفال الذين يعانون من التوحد. يوفر نطاق وقطع العرضية لغير المصابين بالتوحد (15-29)، خفيفة الى معتدلة (30-36)، وشديد (> 37) مستويات السلوك يعانون من التوحد.
باستخدام مقابلة منظم، وأيضا طلب من الآباء والأمهات بصورة منتظمة حول سلوك أنهم وجدوا إشكالية من حيث الإدارة في المنزل أو في المدرسة.


معدل الذكاء

وكان متوسط ​​مقياس IQ كامل 65.7 (ن = 16، SD 16.2، ومجموعة 42-108)، يعني كان IQ اللفظي 66.3 (ن = 19، SD 13.5، ومجموعة 46-93)، ويعني كان IQ الأداء 65.7 (ن = 16 ، SD 21.6، تتراوح 46-127). سوى ثلاث أطفال (17.6٪) الذكاء واسعة النطاق في المدى المتوسط ​​(≥80). كان الأطفال أحد عشر الذكاء واسعة النطاق في نطاق التخلف العقلي (<70)، فإن الغالبية (ن = 10) في نطاق معتدل التخلف العقلي (50-69).
التدابير السلوكية

وتتلخص نمط درجات على CBCL في الجدول 1. من حيث السلوك خارجيا، المجموعة تعني نتيجة 53.2 (SD 10.8) وطفل واحد فقط سقطت فوق قطع لأهمية سريرية مع أي طفل إضافي تتساقط فوق قطع الشريط الحدودي إيقاف. من حيث internalising السلوك، وكانت النتيجة متوسط ​​62.8 (SD 11.2). انخفض خمسة أطفال فوق قطع لأهمية سريرية وقطع طفلين مزيد من فوق الشريط الحدودي قبالة. كان الفرق بين internalising وخارجيا السلوك كبيرا (إقران اختبار تي، تي (DF = 20) = 5.17، p <0.001). من حيث نمط درجات على سلم الدرجات الثانوي الفردية، وقد تم الحصول على درجات عالية نسبيا أيضا في المقاييس التي لا تندرج في أي من خارجيا أو عوامل internalising (مشاكل اجتماعية، ويعتقد المشاكل، مشاكل الانتباه). والجدير بالذكر، وسجل عدد قليل جدا من الأطفال في مجموعة السريري الإكلينيكي أو الشريط الحدودي على الفروع الجانبية العدوانية والانحراف.

الجدول 1
ملخص درجات على CBCL

الانتهاء من الآباء 12 فقط CARS التدبير. وكانت النتيجة متوسط ​​28.3 (SD 8.2). وسجل اثنين من 12 طفلا (16.7٪) في نطاق التوحد خفيفة معتدلة وسجل طفلين المزيد من (16.7٪) في نطاق التوحد الشديد.
والدي كل طفل 21 الانتهاء من CRI. وكانت النتيجة متوسط ​​8.7 (SD 4.8). ويقارن هذا إلى النتيجة يعني (SD) من 7.0 (4.6) للعادة وضع 72 طفلا منذ شهر، 34 13.1 (5.1) للأطفال المصابين بمتلازمة برادر ويلي، و14،0 (4،1) للأطفال المصابين بالتوحد (شارمان وآخرون، غير منشورة البيانات).
وأظهرت المقابلات الوالدين تنظيما مزيد من الخصائص السلوكية للعينة. وذكر والدا 19 من 21 طفلا (90.5٪) أن طفلهم كان اجتماعيا وغير ناضج عاطفيا. تم الإبلاغ عن سبع عشرة أطفال (80.9٪) لديهم هواجس، 12 (57.1٪) يفضلون الروتين، 12 (57.1٪) لمثل لعب نفس اللعبة مرارا وتكرارا، وتسعة (42.9٪) لمثل جمع الأشياء، و 13 (61.9 ٪) لاجراء محادثات مع أنفسهم.


من حيث ما إذا كان ينظر النمط الظاهري السلوكي المميز في BBS، برز عدد من النتائج المهمة المحتملة. كان المستوى العام للاضطراب السلوكي مقاسا CBCL عالية نسبيا، ما بين ربع ونصف من العينة تبين مستويات السريرية الإكلينيكية أو الشريط الحدودي اضطراب عبر الفروع الجانبية. والجدير بالذكر، ونادرا ما ذكرت مستويات السريرية للسلوك خارجيا بما في ذلك العدوان والجنوح. في المقابل، internalising المشاكل بما في ذلك سحب، جسدية، والقلق / المزاج المكتئب كانت متكررة، وكذلك مشاكل مع السلوك الاجتماعي والفكر اضطراب، والاهتمام. وهكذا، فإن الصعوبات السلوكية يتضح من الأطفال الذين يعانون من BBS تختلف عن تلك التي شوهدت في أكثر شيوعا الاضطرابات العصبية والنفسية ADHD وإجراء الفوضى. 33 على الرغم من أن العديد من فئات الأطفال معتدلا مع المعرض التخلف العقلي ارتفعت مستويات السلوك بالانزعاج على CBCL، لا internalising ولا ارتبط وخارجيا مع IQ في العينة الحالية (ص = -0.20 و r = -0.31، على التوالي، على حد سواء P> 0.10). المستويات المطلقة لاضطراب على CBCL هي مماثلة لتلك التي وجدت في عينات من الأطفال الذين يعانون من اضطرابات وراثية أخرى (على سبيل المثال، متلازمة برادر ويلي)، 36 على الرغم من أن في غيرها من المتلازمات الوراثية الاضطراب السلوكي على CBCL يبدو أن أقل شيوعا (على سبيل المثال ، VCFS). 37 والتعرف على تعريف معين نسبيا من الاضطراب السلوكي على CBCL (صورة تهيمن عليها internalising عالية والاجتماعية ويعتقد المشاكل، ولكن انخفاض مستويات خارجيا مشاكل) مهم للقضية السريرية للإدارة والمشورة للوالدين . في العينة الحالية الكثير من هذه الحاجة السريرية والتي لم تتم تلبيتها وكان عدد قليل من الأسر تلقت مساعدة الخبراء حول إدارة السلوكية.
وكانت بيانات عن السيارات المتوفرة على نصف العينة، ولكن أربعة من 12 الآباء والأمهات الذين الانتهاء من الإجراء المشار إليه قدرا كبيرا من أعراض مثل التوحد. سجل طفل واحد 45.5 على CARS، بالإضافة إلى "التوحد الشديد" مجموعة من المقياس. ومع ذلك، التقييم السريري لهذا الطفل، بما في ذلك استخدام أداة التشخيص منظم، وتشخيص التوحد المنقحة مقابلة (ADI-R) 38 أظهرت أنها لم تستوف المعايير السريرية لمرض التوحد. وسجل هذا الطفل فوق قطع على المعاملة بالمثل الاجتماعي والسلوكيات المتكررة والنمطية أبعاد أنماط ولكن ليس على البعد الاتصالات. ظهرت أي نمط ثابت من حيث CARS العناصر التي أيدها أكثر في كثير من الأحيان في العينة. وهذا هو، في حين سجل بعض الأطفال منخفضة جدا على البنود الاجتماعية وارتفاع على البنود السلوك المتكررة، وأظهر البعض الآخر النمط المعاكس.
على CRI، أظهرت العينة الحالية مستويات الروتين والطقوس زادت مقارنة بالأطفال النامية عادة (ومنهم قبل سن 72 شهرا CRI بدأت في الانخفاض)، وإن كان أقل مما كان عليه في عينات من الأطفال المصابين بمتلازمة برادر ويلي و التوحد (شارمان وآخرون، بيانات غير منشورة). صحه نشرت هذه التقارير من الهوس، والسلوك الطقسي القهري في بعض المرضى الذين يعانون من BBS. 18 وذكر الآباء أيضا مستويات عالية من تفضيل الروتين والأنشطة المماثلة وهذه لم تؤثر على الحياة الأسرية في بعض الحالات. على سبيل المثال، كان هاجس صبي واحد مع أي شيء له علاقة مع المصارعة. وقال انه تم جمعها بشكل إلزامي اللعب، والملصقات، والصور، أو أي شيء له علاقة بهذا الموضوع. وكان آخر جامدة حول توقيت وجبات الطعام، وكان أنيق بقلق شديد ومرتبة. وقال انه لا يمكن التعامل إذا كان أي شيء للخروج من المكان، وسوف تفعل سوى عدد قليل من انتقائي الألغاز مرارا وتكرارا. ومع ذلك، لم يرتبط العاهات الاجتماعية والسلوكيات المتكررة ذكرت من CARS وCRI مع IQ أو لغة القدرة داخل العينة.
ترتبط والسلوكيات النمطية بشكل عام مع IQ، وتوجد أكثر شيوعا في المتلازمات الوراثية، ولا سيما تلك التي التخلف العقلي هو شائع. 39، 40 ومع ذلك، هناك أدلة متزايدة على أن المتلازمات الوراثية يمكن أن تظهر الظواهر السلوكية المحددة، إلى جانب الطبية الأولية الخاصة والميزات التنموية. 26- 29، 37 وتشير النتائج الحالية أن مواصلة دراسة سلوك ينظر في المرضى الذين يعانون من BBS بشأنه. وتشمل الأسئلة معينة من الاهتمام كيف السلوكيات مثل تغيير مع التقدم في السن (وشملت العينة الحالية أطفال فقط) ومعدل الذكاء، وعما إذا كانت تختلف وفقا لطفرة جينية. 2 فهم النمط الظاهري السلوكي للBBS مهم أيضا لاتباع نهج شامل لإدارة وتوفير الخدمات لهؤلاء المرضى وأسرهم.
هذه الورقة هي الخطوة الأولى نحو استجلاء النمط الظاهري السلوكية في الأطفال الذين يعانون من BBS

الساعة الآن 10:46 PM.

Powered by vBulletin® Version 3.8.2
Copyright ©2000 - 2020, Jelsoft Enterprises Ltd

a.d - i.s.s.w